Tales from the Annals: Clare Surnames and Y-DNA
Teach Ceoil, Grace Street, Kilrush
WWW version:
YouTube version:
TBA
***** NB: FamilyTreeDNA kits will be
available after this talk for anyone interested via the DNA
Outreach IRL project *****
Introduction
- The Y-chromosome, like the surname, is passed
virtually unchanged from father to son, with just occasional mutations.
- Over hundreds or thousands of years, these
occasional mutations add up to give a wide distribution of different
surname variants and of different Y-DNA signatures today.
- Surname studies have been popular
for a long time.
- The Guild of One-Name Studies (GOONS)
was
established in 1979 and Clans of Ireland ~ Finte na hÉireann
in 1989, both long before direct-to-consumer DNA analysis became
available.
- FamilyTreeDNA became the first company to provide
direct-to-consumer Y-DNA testing to genealogists in 2000.
- Y-DNA analysis has become the poor relation of autosomal
DNA analysis since 23andMe
launched the first autosomal product in 2007.
Y-DNA comparison and matching remains the best way to estimate the
relationship between two men with the same or similar surnames:
- did their most recent common male line ancestor use the
same surname, or a variant of it?
- did their most recent common male line ancestor live within
the surname era (post-1014), but use a different surname?
- approximately when did their most recent common male line
ancestor live?
- approximately when did a man in the relevant male line
first adopt the present surname?
- can we identify a name or dates or places for the most recent
common male line ancestor?
- are they from the same ancient
haplogroup? (The word haplogroup
has long
been used to describe any group of men with similar Y-DNA; its meaning
has evolved with the science of analysing the Y chromosome.)
- are they from the same recent haplogroup?
- do they have a more recent common male line ancestor than
genetic Adam?
- The "biblical Adam" was the first and only male in the
world at the time of creation.
- The "genetic Adam" or "Y-Adam", the most recent common
patrilineal ancestor of all men alive today, was merely the only male
in the world in his day whose
male line descendants have not yet died
out.
- Y-Adam is estimated to have lived between
160,000 and 300,000 years ago.
The science or art of placing men on the human family tree or Tree of Mankind,
often called the Y
haplotree, has evolved
rapidly in recent years.
Overview
Components
of DNA
- DNA is:
- made up of chromosomes and mitochondria, each consisting
of
molecules of four nucleotides
named adenine (A), cytosine (C), guanine (G) and
thymine
(T)
- represented by strings of the letters A, C, G and T
- When a sperm fertilises an egg, each brings DNA, which is
replicated in every cell of the resulting person.
|
male
offspring |
female
offspring |
| sperm |
Y chromosome |
X chromosome |
| 22 paternal autosomes |
| egg |
X chromosome |
| 22 maternal autosomes |
| mitochondria |
- Autosome
is short for autosomal chromosome.
- Each component has its own inheritance path:
- Y chromosome (the subject of tonight's talk)
- Only males have a Y chromosome.
The Y chromosome comes down the patrilineal line - from father,
father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of
arms, peerages, etc.
- X chromosome
- Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not contain two
consecutive males.
Blaine Bettinger's nice colour-coded blank fan-style pedigree
charts show the
ancestors from whom men and women can potentially inherit
X-DNA.
- Autosomes (heavily marketed by AncestryDNA etc.)
- Exactly 50% of autosomal DNA comes from the father and
exactly 50% comes from the mother.
On
average 25% comes from each
grandparent, on average
12.5% comes from each greatgrandparent, and so
on.
- Siblings each inherit 50% of their parents'
autosomal DNA, but not the same 50% (except for identical twins).
- Mitochondria
- Everyone has mitochondrial DNA.
- Mitochondrial DNA comes down the matrilineal line -
from
mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.
Males with an interest in their surname history should submit a sample
of
their own DNA for Y chromosome analysis and then recruit other men with
the same or similar surnames to do likewise.
Females interested in the Y-DNA signature associated with their
surnames do not have a Y chromosome, but can still recruit a father,
brother, uncle, cousin or other male relative with the relevant surname
and Y-DNA signature to swab.
Close relatives with the same surname will have virtually identical Y
chromosomes, so should pool their funds and invest in more advanced
analysis of a single sample, or of samples from unconfirmed relatives.
Surnames
and Y-DNA
Two types of mutation can be found on the Y chromosome, both known by TLAs starting with S::
- A single-nucleotide polymorphism,
abbreviated SNP and pronounced snip,
is a single location where there is a
relatively high degree of variation between different people.
- For example, most people may have an A at one such
location, with a minority having a C.
- A short tandem repeat (STR) is a string
of
letters consisting of the
same short substring repeated several times, for example
CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times.
- The number of repeats may occasionally increase or decrease between
parent and child, due to mutations.
Y-DNA analysis began many years ago by looking at patterns of STR
values from the Y chromosome. These values mutate relatively frequently
in both directions.
- One can purchase Y-DNA12, Y-DNA37, Y-DNA67, Y-DNA111, etc.,
which
compare the number of repeats in 12, 37, 67 or 111 STRs respectively.
- In general, more people have bought the cheaper products, resulting in more numerous matches.
- In general, the more expensive products give fewer, but more meaningful matches.
- My Y-DNA111
matches as of 25 February 2019.
- My top
Y-DNA67 matches as of 25 February 2019.
- These
numbers can be viewed in the Y-DNA results pages for various projects,
such as the Clare Roots project.
More recently, once-in-the-history-of-mankind SNPs began to be
identified:
- These mutations have occurred exactly once.
- Every man
descended from the man in whom the mutation originally occurred
inherits the mutation.
- No other man has the mutation.
- Men with the same
SNP mutation tend to also have similar patterns of STR mutations, so
STR mutations are used to predict SNP mutations.
It was eventually realised that these SNPs are a much better
way of categorising men
than the patterns of reversible STR mutations which were originally
used on their own.
STR analysis remains cheaper than SNP analysis, so it is still the
starting point for Y-DNA analysis.
- STR analysis remains the best way of estimating close
relationships between men of the same surname, particularly a surname
with a single genetic origin
- SNP analysis is
more suitable for large scale
surname studies investigating genetic relationships between men who
have
different surnames or whose surname has multiple genetic origins.
Sometimes, whether one goes further down the STR or SNP route is a
matter of taste and a matter of debate.
Y-DNA analysis can have various objectives, but the
principal ones
include:
- to identify the original surname which was subject to a surname/DNA switch
(SDS), whether known of from other sources (e.g. adoption)
or first discovered through DNA comparisons (e.g. O'Brien/O'Day);
- to identify the most recent SNP mutation in a man's lineage
(e.g. R-FGC29367, R-DC505);
- to determine whether that most recent SNP is specific to
the
man's surname or occurred before the surname was adopted by his male
line
ancestors (e.g. R-FGC29367 is shared by Chaneys,
Wades and Waldrons);
- to identify any STR mutations that have taken place in the
man's
lineage since the most recent SNP mutation and/or since the most
distant known patrilineal ancestor;
- to estimate, using STR mutations, how close the
relationship is
between two men with the same surname and same most recent confirmed
SNP but without a known common ancestor;
- to verify traditions relating to common origins of
different modern surnames;
- etc.
In principle, your match list should contain dozens of men with your
exact surname, e.g. Flannery
or Marrinan.
In practice, there are many reasons why this may not be the case:
- your surname (or your male line beyond the adoption of your
surname) may not be one of those which have
proliferated due to many men of the surname (or male line) each having
several sons;
- your surname (or male line) may be in danger of being
"daughtered out",
due to
many men of the surname (or male line) not marrying or fathering only
daughters;
- there may be no other man of your surname in the FTDNA
database (e.g. no Geheran in February 2019,
although there is a Palmer with Geheran DNA);
- there may be only a few people of your surname in the FTDNA
database (e.g. there were only 11
Dungans of either gender in February 2018, rising to 16 by
February 2019);
- there may have been no concerted effort to recruit men of
your surname to the FTDNA database;
- there may have been a concerted effort to recruit men of
some genetically related surname to the FTDNA database;
- the men of your surname in the FTDNA database may not yet
have ordered any Y-STR product;
- there may have been an above average number of STR
mutations in
your male line in recent generations, resulting in few matches of any
surname;
- there may have been a below average number of STR mutations
in
your male line since the adoption of surnames, resulting in many
matches with men whose common ancestry predates the use of surnames;
- there may have been convergence
of DNA signatures between descendants of ancestors with very different
DNA signatures, again resulting in many
matches with men with no recent common ancestry (e.g Egan and Egan 5/37
apart);
- there may have been an overt or covert surname/DNA switch
in your male line since the adoption of surnames;
- your surname may have multiple independent genetic origins;
- your male line relatives may have translated the surname
between languages in different ways, e.g. Shannon/Giltenane or
Sexton/Tarsnane or Rabbitte/Cunneen or
Judge/Brehony;
- your male line relatives may have settled on different
standardised spellings of the surname once the computer age put an end
to spelling diversity;
- etc., etc.
Remember these simple
concepts:
- Y-DNA follows the male line
- In most cultures the surname generally, but not always,
follows the
same male
line
- In many
cultures grants of arms generally, but not always, follow the male line
and the
surname.
- One surname can have multiple coats of arms.
- One surname can have multiple DNA signatures.
Y-DNA will identify relationships that go back much further
than the adoption of surnames, which in most cultures was around or
after the year 1000 AD.
In practice, there are many exceptions to the foregoing
cultural
principles, which result in sons inheriting DNA from their genetic
father, but inheriting their surname from someone else.
- This is defined
as a surname/DNA switch,
and is one cause of surnames having multiple
DNA signatures.
- Many
surnames, particularly occupational surnames and surnames in countries
which
have had many immigrants, have
multiple
independent
genetic origins for more mundane reasons:
- Native surnames may be translated in multiple ways to an
immigrant language (e.g. to
English in Ireland).
- Immigrant surnames may be translated in multiple ways to
a native language.
- Multiple surnames may be translated to a single surname
in another language.
- When the surname does not follow the male line, some
genetic genealogists once used the term non-paternity event (NPE),
but most now prefer to refer to these occurences more precisely as
surname/DNA
switches.
- After all, every birth involves paternity, so NPE is now
more
usually expanded as "Not the Parent Expected" and used when the DNA
results do not match the oral family tradition.
Among the myriad of, possibly
one-off,
circumstances causing surname/DNA switches
(and other forms of NPE) are:
- adoption or fostering (including of foundlings)
- sperm donation
- inadvertent baby swaps in maternity hospitals
- infidelity
- children using their mother's surname, especially if the mother is unmarried
- children using their stepfather's surname
- a change of surname
associated
with inheritance of a family estate, to keep the land in the family name
- men going on
the run
for all sorts of reasons and changing their surname to avoid being
traced, whether running away from the law, from political opponents, or
from their families, perhaps even wishing to commit bigamy.
FamilyTreeDNA
and its competitors
- Ancestry.com went out of the Y-DNA business on 5 September 2014
- its Y-DNA comparison database evaporated
- its physical Y-DNA samples were due to be destroyed
- customers had the option to download data and upload to
FTDNA
- YSEQ
does Whole Genome Testing, single SNP tests (USD18), etc.
- Ysearch
(to Y-DNA what GEDmatch is to autosomal DNA) is no longer accessible as
a result of GDPR.
- WorldFamilies.net, which hosted surname projects based on
results from the FTDNA lab, also closed down due to GDPR fears in May
2018.
- The International Society of Genetic Genealogy (ISOGG) Wiki
has more on options for STR testing and SNP testing.
A surname project or one-name study is a natural monopoly.
FamilyTreeDNA is now the only effective option for Y-DNA projects:
- If you have autosomal DNA data with another company, you
should join FTDNA via the free autosomal transfer facility.
- If you (or a deceased relative) have already sent cheek
swabs to FamilyTreeDNA for
Family Finder
or mitochondrial analysis, then they are held in storage and will be
re-used
for Y-DNA analysis.
- If you are completely new to genetic genealogy, swab kits
will be available after this talk.
FamilyTreeDNA's main objective is to match those who submit DNA samples
with their closest relatives in the database, and to facilitate
exchange of e-mails between DNA matches.
The optimal order in which to purchase Y-DNA products depends on
which objectives are of most importance, on the results of previous
purchases, and on the budget available.
The prices are less if you join a surname or geographical project
before or at the time of ordering. You may be able to find an
appropriate project here. There are 10,335 to choose
from as of 25 February 2019 (some with an unexplained ![[guild]](https://www.familytreedna.com/images/guild_small.gif "[guild]")
icon).
Alternatively, you can just
do a Google search for
[surname] FTDNA project
The next step is to order a Y-STR product. There are several possible
routes:
- The entry-level purchase is Y-DNA37, which examines 37 STR
locations on the Y chromosome and which can be ordered at a discounted
price through a project, for example (if you have ancestors who lived
in County Clare) the Clare Roots project which I
administer. The Y-DNA37 results can be used as a guide to the best
subsequent purchases.
- The top-of-the-range purchase is Big Y-700.
- If you just want to confirm that you have the same
confirmed SNP mutation as a suspected relative with your surname, then
you can start with the
cheaper Y-DNA12
and order a single SNP test on the advanced SNP order form when the
Y-DNA12 results are available (and
have confirmed that you are a match to your suspected relative).
- Big Y-700 will give you a confirmed recent SNP.
- Y-DNA12 or Y-DNA37 will
give you a predicted ancient SNP.
- Y-DNA12 or Y-DNA37 will give you a list of matches, i.e.
men with
similar patterns of STR values.
- Big Y-700 will also give you a list of matches, i.e. men
from
the same branch of the SNP-based Tree of Mankind.
New FamilyTreeDNA.com customers need to fill in the names of
both their Direct
Maternal (i.e. matrilineal) and Direct Paternal (i.e. patrilineal) Most
Distant
(i.e. most distant known) Ancestors here
in order to help
those looking for mitochondrial DNA matches and Y-DNA matches
respectively. It
is particularly important for anyone who has ordered mtDNA analysis and
for men who have ordered Y-DNA analysis to fill in details of these
ancestors which then appear in the relevant project reports and match
lists.
Most people squeeze in names, places and dates to the limited
string length
of 50 characters available for the names of the most distant ancestors,
but FamilyTreeDNA really should provide separate fields and columns for
name, birth
date, death
date,
country, county, etc., to help those scanning this information in the
tables in
surname projects and mitochondrial projects.
There is also a map-based system for recording
locations of most distant known ancestors, but I have not found it very
useful.
The Y-DNA projects hosted by FTDNA can be
Once you have your initial Y-DNA
results, you can join appropriate haplogroup projects.
Most geography-based projects use some combination of Y-DNA, autosomal
DNA and mitochondrial DNA, e.g. various Irish projects.
Some older project member and project administrator features have been
disabled because of numerous changes prompted by GDPR fears.
You must Opt in to Sharing on the PROJECT PREFERENCES page or your
pseudonymized DNA results and ancestor information will be missing from
the public results pages.
You can also choose from that page whether to give each project
administrator Minimum, Limited or Advanced access to your kit; reducing
access to Minimum pretty much eliminates all the benefits of project
membership.
It is also recommended that you set Y-DNA Match Levels to All Levels on
the PRIVACY & SHARING page.
Example 1: Individual Clare surname projects at FTDNA
Example 2: The Dalcassian surnames
- O'Hart wrote:
91. Cas: the elder son; a quo the Dal
Cais or "Dalcassians;" b. 347. Had twelve sons:—1. Blad, 2.
Caisin, 3. Lughaidh, 4. Seana, 5. Aengus Cinathrach, 6. Carthann Fionn,
7. Cainioch, 8. Aengus Cinaithin, 9. Aodh, 10. Nae, 11. Loisgeann, and
12. Dealbheath.
- Families descended from Cas
include MacArthur, O'Beollan (or "Boland"), O'Brien, O’Brennan,
O'Casey, MacConsidine, O'Cormacan, Cosgrave, MacCraith, (or MacGrath),
O'Curry, Eustace, Glinn, Glynn, Hearne, O'Hogan, O'Hurley, O'Kelleher,
O'Kennedy, Magan, Maglin, MacMahon, O'Meara, Muldowney (now "Downey"),
O'Noonan, Power, Quirk, O'Regan, Scanlan, O'Seasnain, and Twomey.
- Another version.
- Genetic similarities have been
found in the last decade between men with these related
Dalcassian surnames.
- They generally have Irish
Type III DNA characterised
by the L226 SNP in Haplogroup R.
- yfull.com
currently reports that L226 was formed 4200 ybp, TMRCA 1350 ybp
- There is a project set up at Family Tree DNA for the R-L226 Haplogroup.
- 18.3% (92/504) of the men with Y-DNA results in
the Clare Roots project are confirmed or predicted L226+.
- Surname-specific SNPs are now
being discovered for the main Dalcassian surnames and will eventually
be discovered for all common
surnames.
Example 3: The Corcomroe (Corca Modhruadh) surnames
- Within the Clare Roots project, many common
County Clare surnames are found to share the L1336 SNP mutation:
| Surname |
Clare
1911 |
Ireland
1911 |
Clare
% |
| McGuane |
274 |
282 |
97.2% |
| Marrinan |
266 |
281 |
94.7% |
| Marinan |
54 |
59 |
91.5% |
| Cahir |
111 |
134 |
82.8% |
| Considine |
727 |
896 |
81.1% |
| Davoren |
121 |
185 |
65.4% |
| O'Loughlin |
617 |
1257 |
49.1% |
| McNamara |
2194 |
6645 |
33.0% |
| Donnellan |
324 |
996 |
32.5% |
| Hanrahan |
442 |
1836 |
24.1% |
| Neilon |
6 |
30 |
20.0% |
| Clancy |
647 |
3650 |
17.7% |
| O'Brien |
1666 |
24537 |
6.8% |
| O'Neill |
623 |
18431 |
3.4% |
| O'Donnell |
452 |
13510 |
3.3% |
| Cunningham |
256 |
8965 |
2.9% |
| O'Laughlin |
1 |
60 |
1.7% |
| Carroll |
215 |
13815 |
1.6% |
| O'Carroll |
4 |
569 |
0.7% |
| Dunn |
1 |
1478 |
0.1% |
| Marnen |
0 |
0 |
#DIV/0! |
- 8.1% (41/504) of the men with Y-DNA results in
the Clare Roots project are confirmed or predicted L1336+.
- The O'Loughlins were one of the two most powerful families
of Corcomroe: see pedigree.
- According to Cairney, "The chief families of
the Corca Modhruadh were the O’Connors, MacCurtins, O’Loghlens,
O’Davorens and the Corca Thine."
- Davoren and O'Loughlin are prominent surnames in this Y-DNA
grouping, so it probably includes the descendants of the Corca
Modhruadh.
- L1336 has also been referred to as the "Clans of North
Clare" SNP.
- yfull.com has no estimate of the age of L1336.
- Several of these surnames appear in both the L226 and L1336
groups
Conclusion: Why you should submit your DNA
- The value of DNA "testing"
to genealogists increases dramatically with the number of people from
the relevant geographical area and relevant extended family group
already in the DNA databases used.
- Submitting your Y-DNA to a
database has significant positive externalities for existing and future
researchers, especially for your female relatives who don't have a Y chromosome.
- We need to persuade more
Clare men and women to
submit
DNA samples to the databases for purely genealogical purposes.
- Your descendants will be eternally
grateful to you for leaving them your DNA.
Further reading