Reconstructing West Clare Family Histories using DNA

Kilrush and District Historical Society

8:00 p.m. Tuesday 29 November 2016

Teach Ceoil, Grace Street, Kilrush

by Paddy Waldron

WWW version:

http://pwaldron.info/DNA/Kilrush/

Facebook event:

https://www.facebook.com/events/675014689323528/

YouTube version:

https://www.youtube.com/watch?v=GgYrt4npKqk

What is DNA?

short for deoxyribonucleic acid
made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
represented by strings of the letters A, C, G and T

Where does our DNA come from?

When a sperm fertilises an egg, each brings DNA, which is replicated in every cell of the resulting person.

	male offspring	female offspring
sperm	Y chromosome	X chromosome
	22 paternal autosomes
egg	X chromosome
	22 maternal autosomes
	mitochondria

autosome is short for autosomal chromosome.

Inheritance paths

Y chromosome: Only males have a Y chromosome.
The Y chromosome comes down the patrilineal line - from father, father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.
X chromosome: Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not contain two consecutive males.
Blaine Bettinger's nice colour-coded blank fan-style pedigree charts show the ancestors from whom men and women can potentially inherit X-DNA.
Autosomes: Exactly 50% of autosomal DNA comes from the father and exactly 50% comes from the mother.
Due to recombination (see below), on average 25% comes from each grandparent, on average 12.5% comes from each greatgrandparent, and so on.
Siblings each inherit 50% of their parents' autosomal DNA, but not the same 50% (except for identical twins).
Similarly, siblings each inherit 50% of their mother's X DNA, but not the same 50% (except for identical twins).
Sisters each inherit 100% of their father's X DNA.
Mitochondria: Everyone has mitochondrial DNA.; Mitochondrial DNA comes down the matrilineal line - from mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.

For genetic genealogy, beginners should start with autosomal DNA, or with Y DNA for one name studies or surname projects.

How much DNA do we have?

Billions of letters:

	Male			Female
	Length	Width	Total	Length	Width	Total
Autosomal	2,881,033,286	2	5,762,066,572	2,881,033,286	2	5,762,066,572
X	155,270,560	1	155,270,560	155,270,560	2	310,541,120
Y	59,373,566	1	59,373,566			0
Mitochondrial	16,569	1	16,569	16,569	1	16,569
GRAND TOTAL	3,095,693,981		5,976,727,267	3,036,320,415		6,072,624,261

How much DNA do we observe?

The three major DNA companies sample different locations on the autosomes - about 0.02% of the total:

FamilyTreeDNA (Family Finder): 682,608
AncestryDNA: 658,780 (reduced to 441,447 from May 2016)
23andMe: 577,382

The overlap between FamilyTreeDNA and the original AncestryDNA set is 652,462 (based on my personal results).

The random component of DNA inheritance

Most DNA is transcribed exactly from the relevant parent.

Two sources of randomness mean that one cannot always exactly infer the child's DNA from the parents' or vice versa:

mutations
recombination

Mutations are transcription errors at single locations, e.g. a single A in the parent may be replaced by a C in the child.

Some locations mutate very frequently (every couple of generations), and can be used to identify individuals beyond reasonable doubt, e.g. in criminal cases.

Some locations mutate less frequently (only once in many generations or once in the history of mankind), and can be used to identify closely or distantly related individuals.

The vast majority of DNA is identical for all humans, and even for many of the apes.

Special types of mutations:

Short Tandem Repeat (STR): a string of letters consisting of the same short substring repeated several times, for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be repeated less or more often in other individuals.
Single Nucleotide Polymorphism (SNP): a single location where two (or occasionally more than two) different letters are observed in different individuals.

Y-DNA Mutations

The entry-level Y-DNA37 product looks at 37 STR markers on the Y chromosome, e.g. Clancy Surname Project or The Marrinan Family or O'BRIEN Y-Chromosome DNA Surname Project.
Some SNPs on the Y chromosome are once-in-the-history-of-mankind events and can be used to build a Y-DNA Haplogroup Tree.
STRs can predict Y haplogroups but a SNP product must then be purchased to confirm the Y haplogroup.
Surname-specific SNPs are now being discovered.

mtDNA Mutations

There is also an mtDNA Haplogroup Tree.

Autosomal DNA Mutations

The 0.02% or so locations observed on the autosomes are known SNPs.
All observed SNPs are still weighted equally in relationship calculations, but two individuals who share a mutation observed in only 1% of the population are likely to be far more closely related than two individuals who share a mutation observed in 50% of the population.

Recombination

The other source of randomness is recombination, which is how, e.g., the father's paternal and maternal autosomes cross over to produce the child's paternal autosomes.

Every sperm/egg is potentially unique.
Recombination of the paternal and maternal chromosomes is sometimes compared to shuffling two decks of playing cards.
Recombination rates very markedly along the autosomes and the X chromosome.
The local recombination rate is referred to as genetic length and is measured in units called centiMorgans, which estimate the number of generations to the common ancestor of two individuals sharing an identical long run of letters.
One recombination per generation is expected in each 100 centiMorgans (cM, not cm).
The longer the centiMorgan length of two identical DNA segments, the more recently one can expect to find the common ancestor from whom they were inherited.
On average, there are 798,852 total letters per cM or 190 letters observed per cM, or one recombination or crossover per generation per 19,000 observed letters.

The double negative approach: opposite homozygous locations and half-identical regions

Current technology can observe two letters at each location, but cannot distinguish between the paternal and maternal letters.
Future technology may allow segments of one person's paternal or maternal chromosome to be compared directly with segments of another person's paternal or maternal chromosome.
In the meantime, autosomal DNA matching is based on a double negative approach:

The two of you might have inherited your DNA from a common ancestor at any location except where you definitely did not.

In practice, almost all of the observed locations are bi-allelic - i.e. only two letters have been observed.
At a bi-allelic location (e.g. where only A and G are observed):

individuals with different letters from each parent (e.g. AG) are called heterozygous
individuals with the same letter from both parents (e.g. AA or GG) are called homozygous.

How can we tell whether two individuals inherited a particular location from a shared ancestor?

two individuals who are opposite homozygous at a particular location (e.g. one AA and the other GG) definitely did not inherit that location from a common ancestor.
otherwise we cannot rule out a common ancestor:

AA and AG could have the A from a common ancestor;
GG and AG could have the G from a common ancestor;
two AGs, two AAs or two GGs could have both letters from common ancestors.

Between one opposite homozygous location and the next, the chromosomes are broken up into half-identical regions where at least 1-out-of-2 letters is common to both individuals.
Example

If As and Gs are equally likely, then one location in eight is on average opposite homozygous.
If one letter is more likely than the other, then opposite homozygous locations are less frequent than one-in-eight.
Long half-identical regions could contain identical segments inherited from common paternal/paternal, paternal/maternal, maternal/paternal or maternal/maternal ancestors.
The longer a half-identical region, the more likely it is to contain an identical segment (probably with fuzzy boundaries at each end), and the higher the probability of a recent common ancestor.
To find possible relatives, concentrate on runs of 1000 or more SNPs with no opposite homozygous locations.
A half-identical region is described by:

Chromosome number (1-22 or X)
start location
end location
estimated centiMorgan length
number of SNPs observed
names of the two parties being compared.

e.g.

5 149,295,480 169,691,785 27.0 2443 John/Ger

Match list
Chromosome browser

False positives can occur - a long half-identical region can by chance consist of short overlapping (or zig-zagging) paternal/paternal, paternal/maternal, maternal/paternal and maternal/maternal segments.

Phasing and triangulation are like opposite sides of the same coin:

If you are half-identical to two people on the same region, where they are not half-identical to each other, then one must match your paternal chromosome and the other must match your maternal chromosome:

phasing is the term used for separating the observed letters into paternal and maternal chromosomes, or separating the observed matches into paternal and maternal relatives.

If you are half-identical to two people on the same region, where they are half-identical to each other, then all three of you must have inherited DNA in that region from a single common ancestor:

triangulation is the term used for identifying three people descended from a common ancestral couple. (More information is usually required to determine whether the shared DNA came from husband or wife in that couple.)

Rule of thumb for lengths of the longest half-identical region::

30 cM+: good chance of finding the common ancestor
20 cM+: worth investigating
10 cM+: probably too distant to trace in surviving Irish genealogical records
under 10cM: possibly half-identical by chance
reduce these thresholds if there is other solid evidence of a relationship
50 cM+ in extreme cases (see below) can still be shared by fourth cousins or even more distant cousins

The aggregate length of all the half-identical regions above some arbitrary threshold is used to estimate the relationship:

1cM threshold for FamilyTreeDNA (provided one segment is 7cM or more)
7cM threshold for GEDmatch

Average autosomal DNA shared by pairs of relatives:

in theory; and
in practice.

What can DNA tell us?

With one sample, you can fish for long-lost cousins in three commercial pools and one non-commercial pool (GEDmatch.com).
With two samples, you can confirm or disprove theories about relationships (e.g. Richard III).
It can potentially break through all sorts of genealogical brick walls.
For people with adoptions (or foundlings) in their family history, it may be the only option to find their genetic family; such people are disproportionately represented in all the databases, even compared to the 2% adoption rate in the past.
Those whose genetic ancestry has been concealed from them have a right, and usually a great desire, to know it.
On the other hand, if there is a family secret that you, or others in your family, would like to remain a secret, then genetic genealogy may not be for you.
Ethnicity
- sensitive to the (unspecified) reference population
- distorted by recombination (e.g. 33% rather than 25% from one grandparent)
- "genetic astrology"
- most Irish people are 100% Irish (or 100% British Isles according to one company)
- great marketing value in the U.S. melting pot
Data-mining, lies, damned lies and statistics

The big 3 DNA companies

AncestryDNA: Part of ancestry.com
Autosomal DNA only; Very limited analysis tools
Overcharges non-U.S. customers
Internal messaging system
Reached 1 million samples in July 2015; 2 million samples in June 2016; Most people use pseudonyms or initials
My results
23andMe: Concentrates on medical aspects of DNA; Autosomal DNA plus predicted Y-DNA and mtDNA haplogroups
Overcharges non-U.S. customers
Optional internal messaging system
About 1 million samples; Most people anonymous; Analysis tools for non-anonymous matches
"Preparation for the transition to the new 23andMe experience" (including doubling of prices) started in October 2015 and still ongoing as of November 2016
Results
Surname View
FamilyTreeDNA (FTDNA): Dedicated to genetic genealogy
Autosomal DNA (Family Finder) plus various Y-DNA and mtDNA products; Good analysis tools
Single worldwide price; No U.S. bias
Simple e-mail communications
600,000+ samples (?400,000 Family Finder and 200,000 Y-DNA only or mtDNA only); Most people use real names: but married women recommended to use maiden surnames; Projects - e.g. Clare Roots and surname projects
My results
My cousin's results

What do you get for your money?

An online list of DNA matches, ordered by closeness of relationship
Regular updates as the database grows
Ethnicity estimates
Raw data to use at third-party websites
Various tools for analysing matches and data
Surname projects (FTDNA only)
Other projects (FTDNA only)

The third-party sites

GEDmatch.com

DNAgedcom.com

featuring ADSA

Levels of involvement

Lists of names: A black box algorithm can be used to list the names of those in a database whose autosomal DNA is closest to yours.; You can look at your matches' own names, their ancestral surnames, ancestral placenames and family trees, if they have made these available.; Anybody can do this.
Lengths of half-identical regions: To get full value from one's investment in DNA analysis, one should move on from the purely qualitative approach of looking at names and take a more quantitative approach.; The first step is to look at the centiMorgan lengths of the regions on which one is half-identical with a potential relative.; The higher this percentage, the closer the relationship is likely to be.; Some basic arithmetic skills are required for this.
Locations of half-identical regions (phasing and triangulation): If three or more people are all half-identical to the others on the same region, and if two or more of them are known relatives, then it becomes far more likely that they are all descended from a common ancestral couple.; Furthermore, it can be inferred that the DNA in the half-identical region has been inherited from either the male or the female of that common ancestral couple.; This may exercise your brain cells a little more than the first two approaches.
Raw data: Sooner or later, the only answer to a particular DNA puzzle will be to look at one's raw data, in the form of long sequences of pairs of As, Cs, Gs and Ts, in order to work out exactly how and why something happened.; This is for the specialist.

Whatever level of involvement you choose, you have a responsibility to provide your DNA matches with at least an outline pedigree chart showing your direct ancestors (FamilyTreeDNA, AncestryDNA).

The easiest way to do this is to upload a GEDCOM file from your desktop genealogy software.

The examples that follow show how to combine three sources of information to reconstruct family histories:

oral tradition
archival records
DNA evidence

Example I: Gorman/McMahon of Moveen etc.

In Griffith's Valuation in 1855, Patrick Gorman and James Gorman lived in no. 7a and no. 8a in Moveen West.
Oral tradition is that some of these Gormans and/or their descendants later lived on Carrigaholt beach and later still at Gorman's Cross in Breaghva.
The McMahons of Baltard [Ballard] acquired one of the Gorman farms in Moveen West and were said to be related.
But the wife of James Gorman of Moveen was Margaret Shea of Breaghva, not a McMahon as in the oral tradition (3rd last entry, right-hand page).
Who were the nieces and nephew in Martin McMahon's household in Ballard in 1911?
Maria Kitson, "niece", was really a granddaughter.
Michael Marrinan, "nephew", was really a greatnephew, son of Michael Marrinan and Mary Gorman. See Entry 478 in birth registers released in September 2016.
So was it really James and Mary Gorman's MOTHER who was the McMahon?
Michael Marinan [sic, one R] and Mary Gorman had a daughter Bridget (Entry 27) born on 28 December 1880 in Moveen.
Delia Marrinan (b. 28 Dec 1880 Ireland) appears in her greatgrandson's online family tree with no further ancestry listed.
I have access to AncestryDNA results for a greatgrandson and greatgreatgrandson of Martin McMahon's brother Patrick.
Delia's greatgrandson appears on both match lists!
So James Gorman's mother was surely an older sister of Martin and Patrick, probably the Bridget Gorman mentioned in The Irish American of 26 September 1863:
At a late Carrigaholt petty sessions, Thomas
Lynch, who had been on two previous occa-
sions remanded in consequence of Bridget
Gorman's continued illness, on whom he was
charged with having committed an assault on
the 1st July, at Moveen, whilst she was at-
tempting to impound his cattle, was again re-
manded for eight days on the evidence of Dr.
Mahony, who would not undertake to say that
the woman was out of danger.
And we can add three generations of Bridget/Delia Marinan/Marrinan's ancestors to her greatgrandson's family tree:

Delia's parents Michael Mar(r)inan and Mary Gorman;
her grandparents Patrick Gorman and Bridget McMahon; and
her greatgrandparents Edmond McMahon and Johanna Lynch buried in Killard:
Erected by Pat McMahon in memory of his beloved father Edmond McMahon who died May 17th 1860 aged 73 yrs also his mother Johanna McMahon alias Lynch Sept 4th 1850 aged 50 and beloved son Thomas McMahon April 13th 1877 aged 12 yrs. May they R.I.P. Amen.

Example II: My Lynch ancestor was Irish - what townland was he from?

Eugene/Owen Lynch was born in "Ireland" around 1869 and died in San Francisco in 1917.
Oral tradition is that an O'Dea farm in Moveen West, County Clare, was divided between two sisters, who married Lynch and Connell respectively, around 1820.
In the Tithe Applotment Book of 17 Nov 1827 for Moyarta parish "Mich'l Lynch 7 Div" occupied a total of 15 Irish acres and two lines below him "Patt Connell 7 Div" occupied a total of 16 Irish acres, the difference being 1 acre of 4th quality land.
In Griffith's Valuation, Mary Lynch née O'Dea had the entire Lynch holding of almost 69 statute acres (no. 9a) but the Connells are omitted.
We have DNA samples from Claire (whose mother was a Lynch) and Ed (whose mother was an O'Connell) and based on this oral tradition they are fourth cousins:
```
8 8,292,285 54,555,905 50.2 10692 Claire/Ed
```
This shared segment, unusually long for fourth cousins, must have come through the two O'Dea sisters.

Claire and Ed triangulate with several of Eugene Lynch's grandchildren, e.g. Michael:

8 17,609,398 38,378,638 27.4 5563 Ed/Michael
8 17,648,866 37,812,773 26.9 5499 Michael/Claire

So, based on the combination of dates with DNA evidence, Eugene must be a grandson of Michael Lynch and Mary O'Dea who married around the early 1820s and whose first names are known from the death certificate of their son Daniel who emigrated to Newtown, Connecticut.
We are lucky that the shared DNA came through a female ancestor and the newly discovered relatives have inherited her husband's surname, so there is no doubt where they fit in the family tree, apart from the first name of Eugene's father.
Five Lynch siblings and one of their children were in Moveen recently.
Their potential second cousin has agreed to provide a DNA sample.
Photo album (for Facebook friends).
"That day was the highlight of our trip to Ireland, and for me it was an unbelievable gift. I have been wondering and imagining for so long about my grandfather's (and thus my own) origins that I still quite can't believe I went there. It was a profound and moving experience for me. My sister Pat and I speak of it often ... It was magical to us. Both of my parents were from families who didn't stay connected with their homeland, and this journey has really fulfilled a need that I hadn't realized I had. I'll be forever grateful to Tom Kearney for introducing me to you, and to you for so generously sharing your expertise with us."

Example III: From A Little Cottage In Clare: The Down(e)s family

DNA has let the genie out of the bottle as regards secret adoptions and fosterings.
This is the story of how several Down(e)s descendants found each other.
10 June 2015: Downes descendant from New York approaches Clare Roots Society in advance of a 50th birthday first-ever visit to his ancestral homeland and wrote about his visit.
19 June 2015: Dana Downs shows up with by far my biggest half-identical region with a stranger thrown up in almost two years of genetic genealogy:
```
12 93,176,484 125,287,936 44.6 8319 Paddy/Dana
```
8 July 2015: William Brown e-mails me about a GEDmatch match to my maternal first cousin:
```
4 102,789,472 114,229,035 10.3 2079 Bill/Mary
```

But I noticed that he also matched Dana:

12 24,432,115 60,468,339 30.1 7961 Bill/Dana
15 22,377,651 30,755,131 19.3 1868 Bill/Dana

All three people descend from Downes emigrants who left from the same house in County Clare.
Two of the three emigrants had children born out of wedlock who were brick walls for their descendants, prompting them to submit DNA samples.
Bill and Dana are double third cousins once removed.
Dana is my fourth cousin with most recent common ancestral couple Hugh Clancy and Marcella Blackall.
My Clancy ancestors and the Downes ancestors were near neighbours in County Clare.
Three quarters of Dana's family tree was very complete, but her grandfather Raymond came to foster parents in Texas on an orphan train in 1904 or 1905.
Raymond's birth parents were known to be called Henry Clancy and Catherine Down(e)s and he used his mother's maiden surname.
Cath Downes sailed on the Teutonic from Queenstown on 21 September 1899 (line 22).
Hewry [sic in transcript] Clancy sailed on the Lucania from Queenstown on 31 December 1899 (also line 22).
Raymond was born in Manhattan on 24 January 1900.
In the census of June 1900:

Raymond Downs (white, male, b. Jan 1900) was an Inmate in the New York Foundling Asylum at 175 East 68 St. in New York (line 72).
Kate Downs (white, female, b. May 1880 in New York [sic] to New York [sic] born parents) was an Inmate and nurse also in the New York Foundling Asylum (line 91).
Harry Clancy (b. Apr 1874 in Ireland to Irish parents, single, migrated 1899, 6/12 year in United States, alien, Car blacksmith) was a boarder with the Haley family at 512 Spruce Street in the 9th Ward of Terre Haute City in Harrison Township in Indiana (line 68).

Henry Clancy travelled to New York especially to finally marry Catherine Downes on 2 October 1904.
Their daughter Margaret Clancy (18 July 1905-26 December 1994) never married.
Did she know that she had a full brother in Texas?

Example IV: The Talty millions - did the wrong people get the inheritance?

My greatgrandfather was one of the supposed heirs to the Talty Millions in the late 1920s.
In the mid-1860s, Timothy Talty and his wife Margaret (née McNamara) and several children emigrated from Knockanalban in County Clare to Lowell, Massachusetts.
When their youngest child T. J. Talty died in Florida on 1 April 1926, it was believed that his next of kin were his surviving first cousins and children of pre-deceaesd first cousins.
The lawyers got most of the money, and the cousins got the rest.
In August 2007, Christiane in Australia began posting queries about her Irish-born ancestor Mary Talty, whose parents are named on her marriage certificate as Timothy Talty and Margaret McNamara.
Did Mary go to Australia on her own before the rest of the family went to Lowell? Or were there two parallel families?
My first cousin Antoin and myself are in Christiane's top four FTDNA matches by longest block, confirming that she is our fourth cousin twice removed, through our McNamara greatgrandfather:
```
9 78,642,927 114,907,097 44.6 9497 Paddy/Antoin
9 85,380,931 103,021,449 21.2 4193 Antoin/Christiane
9 85,856,264 103,021,449 20.9 4120 Christiane/Paddy
```
Christiane's ethnicity is 47% Eastern Europe; 43% Western and Central Europe; 7% Finland and Northern Siberia; 3% Asia Minor; 0% British Isles.
My ethnicity and Antoin's are both 100% British Isles.

Example V: West Clare ethnicity

FTDNA results appeared on 18 October for one of my latest West Clare recruits:

All of his greatgrandparents married before civil registration of Catholic marriages began in 1864.
Seven of his top 30 matches were people that I had met, living in Clare or with Clare roots.
I met an eighth later that day.
I swabbed six of these myself.
Only one is a known relative.

Results like this confirm my statistical theories:

Any two randomly selected Irish people have a 95% chance of being 12th cousins or closer.
Any two randomly selected Clare people have a 95% chance of being 9th cousins or closer.
Any two randomly selected West Clare people are probably even more closely related.
In theory, two fifth cousins have only 10% probablility of being FTDNA-overall-matches.
In practice (when advanced matching worked), one member of the Clare Roots project was an FTDNA-overall match to more than 10% of the other project members.
Does this mean that she is on average more closely related than 5th cousin to everyone in Clare?

We are all descended from Brian Boru, and not just in Thomond.

Conclusion: Why you should submit your DNA

The value of DNA "testing" to genealogists increases dramatically with the number of people from the relevant geographical area and relevant extended family group already in the DNA databases used.
Submitting your DNA to a database has significant positive externalities for existing and future researchers.
We need to persuade more Clare people to submit DNA samples to the databases for purely genealogical purposes.
Your descendants will be eternally grateful to you for leaving them your DNA.