Genetic Genealogy Question and Answer Session.

Clare Roots Society monthly meeting

8:00 p.m. Thursday 19 May 2016

Maguire Suite, Old Ground Hotel, Ennis

WWW version:

What is DNA?

short for deoxyribonucleic acid
made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
represented by strings of the letters A, C, G and T
different people inherit different strings of letters
DNA matches can be long-lost relatives

Where does our DNA come from?

When a sperm fertilises an egg, each brings DNA, which is replicated in every cell of the resulting person.

	male offspring	female offspring
sperm	Y chromosome	X chromosome
	22 paternal autosomes
egg	X chromosome
	22 maternal autosomes
	mitochondria

autosome is short for autosomal chromosome.

Inheritance paths

Y chromosome: Only males have a Y chromosome.
The Y chromosome comes down the patrilineal line - from father, father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.
X chromosome: Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not contain two consecutive males.
Blaine Bettinger's nice colour-coded blank fan-style pedigree charts show the ancestors from whom men and women can potentially inherit X-DNA.
Autosomes: Males and females all have 22 autosomes.; Exactly 50% of autosomal DNA comes from the father and exactly 50% comes from the mother.
Due to recombination (see below), on average 25% comes from each grandparent, on average 12.5% comes from each greatgrandparent, and so on.
Siblings each inherit 50% of their parents' autosomal DNA, but not the same 50% (except for identical twins), so not the same DNA matches.
Similarly, sisters each inherit 50% of their mother's X DNA, but not the same 50% (except for identical twins).
Mitochondria: Everyone, male and female, has mitochondrial DNA.; Mitochondrial DNA comes down the matrilineal line - from mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.

For genetic genealogy, beginners should start with autosomal DNA, or Y DNA for one name studies or surname projects.

How much DNA do we have?

Billions of letters:

	Male			Female
	Length	Width	Total	Length	Width	Total
Autosomal	2,881,033,286	2	5,762,066,572	2,881,033,286	2	5,762,066,572
X	155,270,560	1	155,270,560	155,270,560	2	310,541,120
Y	59,373,566	1	59,373,566			0
Mitochondrial	16,569	1	16,569	16,569	1	16,569
GRAND TOTAL	3,095,693,981		5,976,727,267	3,036,320,415		6,072,624,261

How much DNA do we observe?

The three major DNA companies sample different locations on the autosomes - about 0.01% of the total:

FamilyTreeDNA: 682,608
AncestryDNA: 658,780
23andMe: 577,382

The overlap between FamilyTreeDNA and AncestryDNA is 652,462 (based on my personal results).
Current technology can observe two letters at each location, but cannot distinguish between the paternal and maternal letters.
So we have to be clever to distinguish between paternal and maternal DNA matches.
The vast majority of DNA is identical for all humans.

The random component

Most DNA is transcribed exactly from the relevant parent.

Two sources of randomness mean that one cannot always exactly infer the child's DNA from the parents' or vice versa:

mutations
recombination

Mutations are transcription errors at single locations, e.g. a single A in the parent may be replaced by a C in the child.

Some locations mutate very frequently, and can be used to identify individuals beyond reasonable doubt, e.g. in criminal cases.

Some locations mutate less frequently, and can be used to identify closely related individuals.

Special types of mutations:

Short Tandem Repeat (STR): a string of letters consisting of the same short substring repeated several times, for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be repeated less or more often in other individuals.
Single Nucleotide Polymorphism (SNP): a single location where two (or occasionally three or four) different letters are observed in different individuals.

The entry-level Y-DNA37 product looks at 37 STR markers on the Y chromosome, e.g. U.S. Waldron project or O'Brien project.
Some SNPs on the Y chromosome are once-in-the-history-of-mankind events and can be used to build a Y-DNA Haplogroup Tree.
STRs can predict Y haplogroups but a SNP product must then be purchased to confirm the Y haplogroup.
Surname-specific SNPs are now being discovered.

The other source of randomness is recombination, which is how, e.g., the father's paternal and maternal autosomes cross over to produce the child's paternal autosomes.

Paternal: gtacgatcgtagatcgatcatatccgtacgcatcatgactacatatcatcgatcgatcatcatatcgatcatcagcatcgatcgatcgatcgatcgat
Maternal: gggggggggggggggaccagtatgtatcagtcctattactacatctactataactatctactagctagcaatatcctactcatacatctacttactgt
Combined: gtacgatcgtagatcgatcatatctatcagtcctattactacatctactataacgatcatcatatcgatcatcacctactcatacatctacttactgt

Every sperm/egg is potentially unique.

Recombination of the paternal and maternal chromosomes is sometimes compared to shuffling two decks of playing cards.

Recombination rates very markedly along the autosomes and X chromosome.

One recombination per generation is expected in each 100 centiMorgans (cM, not cm).

The longer the centiMorgan length of two identical DNA segments, the more recently one can expect to find the common ancestor from whom they were inherited.
On average, 798,852 total letters per cM or 190 letters observed per cM, or one recombination or crossover per generation per 19,000 observed letters.

In practice, we cannot distinguish the paternal letter and the maternal letter, so we can only check whether two individual's observed autosomal (or X) DNA is half-identical (or better) at specific locations, e.g.

AA in one person is half-identical (or better) to AA, AC, AG, AT in another person
AG is half-identical (or better) to AA, AC, AG, AT, CG, GG, GT

Phasing and triangulation are like opposite sides of the same coin:

If you are half-identical to two people on the same region, where they are not half-identical to each other, then one of them must match your paternal chromosome and the other must match your maternal chromosome: phasing is the term used for separating the observed letters into paternal and maternal chromosomes, or separating the observed matches into paternal and maternal relatives.
If you are half-identical to two people on the same region, where they are half-identical to each other, then all three of you must have inherited DNA in that region from a single common ancestor: triangulation is the term used for identifying three people descended from a common ancestral couple. (More information is usually required to determine whether the shared DNA came from husband or wife in that couple.)

Rule of thumb for lengths of the longest half-identical region::

30 cM+: good chance of finding the common ancestor
20 cM+: worth investigating
10 cM+: probably too distant to trace in surviving Irish genealogical records
under 10cM: possibly half-identical by chance
reduce these thresholds if there is other solid evidence of a relationship

The aggregate length of all the half-identical regions above some arbitrary threshold is used to estimate the relationship:

1cM threshold for FamilyTreeDNA (provided one segment is 7cM or more)
7cM threshold for GEDmatch

Average autosomal DNA shared by pairs of relatives, in percentages and centiMorgans

What can DNA tell us?

With one sample, you can fish for long-lost cousins in three commercial pools and one non-commercial pool (GEDmatch.com).
With two samples, you can confirm or disprove theories about relationships (e.g. Richard III).
It can potentially break through all sorts of genealogical brick walls.
For people with adoptions (or foundlings) in their family history, it may be the only option to find their genetic family; such people are disproportionately represented in all the databases, even compared to the 2% adoption rate in the past.
Those whose genetic ancestry has been concealed from them have a right, and usually a great desire, to know it.
On the other hand, if there is a family secret that you, or others in your family, would like to remain a secret, then genetic genealogy may not be for you.

The big 3 DNA companies

AncestryDNA: Part of ancestry.com
Autosomal DNA only; Very limited analysis tools
Overcharges non-U.S. customers
Internal messaging system
About 1 million samples; Most people use pseudonyms or initials
My results
23andMe: Concentrates on medical aspects of DNA; Autosomal DNA plus predicted Y-DNA and mtDNA haplogroups
Doubled prices in late 2015
Overcharges non-U.S. customers
Optional internal messaging system
About 1 million samples; Most people anonymous; Analysis tools for non-anonymous matches
Results
Surname View
FamilyTreeDNA (FTDNA): Dedicated to genetic genealogy
Autosomal DNA (Family Finder) plus various Y-DNA and mtDNA products; Good analysis tools
Single worldwide price; No U.S. bias
Simple e-mail communications
400,000+ samples (?250,000 Family Finder and 150,000 Y-DNA only or mtDNA only); Most people use real names: but married women recommended to use maiden surnames; Projects - e.g. Clare Roots, Munster Irish, Pre-Great Famine Munster Ireland Project
My results

What do you get for your money?

An online list of DNA matches, ordered by closeness of relationship
Regular updates as the database grows
Ethnicity estimates (genetic astrology)
Raw data to use at third-party websites
Various tools for analysing matches and data
Surname projects (FTDNA only)
Other projects (FTDNA only)

The third-party sites

GEDmatch.com

DNAgedcom.com

featuring ADSA

Levels of involvement

Lists of names: A black box algorithm can be used to list the names of those in a database whose autosomal DNA is closest to yours.; You can look at your matches' own names, their ancestral surnames, ancestral placenames and family trees, if they have made these available.; Anybody can do this.
Lengths of half-identical regions: To get full value from one's investment in DNA analysis, one should move on from the purely qualitative approach of looking at names and take a more quantitative approach.; The first step is to look at the percentages of the length of the genome on which one is half-identical with a potential relative.; The higher this percentage, the closer the relationship is likely to be.; Some basic arithmetic skills are required for this.
Locations of half-identical regions: If three or more people are all half-identical to the others on the same region, and if two or more of them are known relatives, then it becomes far more likely that they are all descended from a common ancestral couple.; Furthermore, it can be inferred that the DNA in the half-identical region has been inherited from either the male or the female of that common ancestral couple.; This may exercise your brain cells a little more than the first two approaches.
Raw data: Sooner or later, the only answer to a particular DNA puzzle will be to look at one's raw data, in the form of long sequences of pairs of As, Cs, Gs and Ts, in order to work out exactly how and why something happened.; This is for the specialist.

Whatever level of involvement you choose, you have a responsibility to provide your DNA matches with at least an outline pedigree chart showing your direct ancestors (FamilyTreeDNA, AncestryDNA).

The easiest way to do this is to upload a GEDCOM file from your desktop genealogy software.

Why you should submit your DNA

The value of DNA "testing" to genealogists increases dramatically with the number of people from the relevant geographical area and relevant extended family group already in the DNA databases used.
Submitting your DNA to a database has significant positive externalities for existing and future researchers.
We need to persuade more Clare people to submit DNA samples to the databases for purely genealogical purposes.
Your descendants will be eternally grateful to you for leaving them your DNA.