Using Genetic Genealogy to Reconstruct our Family History

All Aboard 2017 initiative / Lifelong Learning Festival

7:00 p.m. Tuesday 4 April 2017

T1.15, Ground Floor, TARA Building, Mary Immaculate College, Limerick

by Paddy Waldron

WWW version:

http://pwaldron.info/allaboard/

Facebook event:

https://www.facebook.com/events/269661226793613/

YouTube version:

TBA

What is Genetic Genealogy?

Genealogy is the study of family history using:

archival sources (censuses, birth/marriage/death (BMD) records, etc.); and
oral tradition (interviews, written memoirs, etc.).

Genetic Genealogy augments this by also using:

DNA (short for deoxyribonucleic acid)

samples collected using saliva or cheek swab kits
one for everyone in the Late Late Show audience on St. Patrick's Day

Technology has now reached the stage that not using DNA is considered the equivalent of not using census returns.
We have a duty to our descendants:

to preserve our oral history by committing our family memoirs to writing; and
to preserve our genetic history by submitting our DNA to a DNA database.

Where does our DNA come from?

DNA is:

made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
represented by strings of the letters A, C, G and T

When a sperm fertilises an egg, each brings DNA, which is replicated in every cell of the resulting person.

	male offspring	female offspring
sperm	Y chromosome	X chromosome
	22 paternal autosomes
egg	X chromosome
	22 maternal autosomes
	mitochondria

autosome is short for autosomal chromosome.

Inheritance paths

Y chromosome: Only males have a Y chromosome.
The Y chromosome comes down the patrilineal line - from father, father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.
X chromosome: Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not contain two consecutive males.
Blaine Bettinger's nice colour-coded blank fan-style pedigree charts show the ancestors from whom men and women can potentially inherit X-DNA.
Autosomes: Exactly 50% of autosomal DNA comes from the father and exactly 50% comes from the mother.
On average 25% comes from each grandparent, on average 12.5% comes from each greatgrandparent, and so on.; Due to recombination (see below), one might inherit, for example, 27% from the paternal grandfather and 23% from the paternal grandmother.
Siblings each inherit 50% of their parents' autosomal DNA, but not the same 50% (except for identical twins).
Similarly, siblings each inherit 50% of their mother's X DNA, but not the same 50% (except for identical twins).
Sisters each inherit 100% of their father's X DNA.
Mitochondria: Everyone has mitochondrial DNA.; Mitochondrial DNA comes down the matrilineal line - from mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.

For genetic genealogy, beginners should start with autosomal DNA, or with Y DNA for one name studies or surname projects.

How much DNA do we have?

Billions of letters:

	Male			Female
	Length	Width	Total	Length	Width	Total
Autosomal	2,881,033,286	2	5,762,066,572	2,881,033,286	2	5,762,066,572
X	155,270,560	1	155,270,560	155,270,560	2	310,541,120
Y	59,373,566	1	59,373,566			0
Mitochondrial	16,569	1	16,569	16,569	1	16,569
GRAND TOTAL	3,095,693,981		5,976,727,267	3,036,320,415		6,072,624,261

How much DNA do we observe?

The three major DNA companies (see below) sample different locations on the autosomes - about 0.02% of the total:

FamilyTreeDNA (Family Finder): 682,608
AncestryDNA: 658,780 (reduced to 441,447 from May 2016)
23andMe: 577,382

The overlap between FamilyTreeDNA and the original AncestryDNA set is 652,462 (based on my personal results).

The random component of DNA inheritance

Most DNA is transcribed exactly from the relevant parent.

Two sources of randomness mean that one cannot always exactly infer the child's DNA from the parents' or vice versa:

mutations
recombination

Mutations are transcription errors at single locations, e.g. a single A in the parent may be replaced by a C in the child.

Some locations mutate very frequently (every couple of generations), and can be used to identify individuals beyond reasonable doubt, e.g. in criminal cases.

Some locations mutate less frequently (only once in many generations or once in the history of mankind), and can be used to identify closely or distantly related individuals.

The vast majority of DNA is identical for all humans, and even for many of the apes.

Special types of mutations:

Short Tandem Repeat (STR): a string of letters consisting of the same short substring repeated several times, for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be repeated less or more often in other individuals.
Single Nucleotide Polymorphism (SNP): a single location where two (or occasionally more than two) different letters are observed in different individuals.

Y-DNA Mutations

The entry-level Y-DNA37 product looks at the numbers of repeats for each of 37 STR markers on the Y chromosome, e.g. Clancy Surname Project or The Marrinan Family or O'BRIEN Y-Chromosome DNA Surname Project.
Some SNPs on the Y chromosome are once-in-the-history-of-mankind events and can be used to build a Y-DNA Haplogroup Tree.
STRs can predict Y haplogroups but a SNP product must then be purchased to confirm the Y haplogroup.
Surname-specific SNPs are now being discovered.

mtDNA Mutations

There is also an mtDNA Haplogroup Tree.

Autosomal DNA Mutations

The 0.02% or so locations observed on the autosomes are known SNPs.
All observed SNPs are still weighted equally in relationship calculations, but two individuals who share a mutation observed in only 1% of the population are likely to be far more closely related than two individuals who share a mutation observed in 50% of the population.

Recombination

The other source of randomness is recombination, which is how, e.g., the father's paternal and maternal autosomes cross over to produce the child's paternal autosomes.

Every sperm/egg is potentially unique.
Recombination of the paternal and maternal chromosomes is sometimes compared to shuffling two decks of playing cards.
Recombination rates very markedly along the autosomes and the X chromosome.
The local recombination rate is referred to as genetic length and is measured in units called centiMorgans, which estimate the number of generations to the common ancestor of two individuals sharing an identical long run of letters.
One recombination per generation is expected in each 100 centiMorgans (cM, not cm).
The longer the centiMorgan length of two identical DNA segments, the more recently one can expect to find the common ancestor from whom they were inherited.
On average, there are 798,852 total letters per cM or 190 letters observed per cM, or one recombination or crossover per generation per 19,000 observed letters.

The double negative approach: opposite homozygous locations and half-identical regions

Current technology can observe two letters at each location, but cannot distinguish between the paternal and maternal letters.
Future technology may allow segments of one person's paternal or maternal chromosome to be compared directly with segments of another person's paternal or maternal chromosome.
In the meantime, autosomal DNA matching is based on a double negative approach:

The two of you might have inherited your DNA from a common ancestor at any location except where you definitely did not.

In practice, almost all of the observed locations are bi-allelic - i.e. only two letters have been observed.
At a bi-allelic location (e.g. where only A and G are observed):

an individual with different letters from each parent (e.g. AG) is called heterozygous
an individual with the same letter from both parents (e.g. AA or GG) is called homozygous.

How can we tell whether two individuals inherited a particular location from a shared ancestor?

two individuals who are opposite homozygous at a particular location (e.g. one AA and the other GG) definitely did not inherit that location from a common ancestor.
otherwise we cannot rule out a common ancestor:

AA and AG could have the A from a common ancestor;
GG and AG could have the G from a common ancestor;
two AGs, two AAs or two GGs could have both letters from common ancestors.

Between one opposite homozygous location and the next, the chromosomes are broken up into half-identical regions where at least 1-out-of-2 letters is common to both individuals.
Example

Long half-identical regions could contain identical segments inherited from common paternal/paternal, paternal/maternal, maternal/paternal or maternal/maternal ancestors.
The longer a half-identical region, the more likely it is to contain an identical segment (probably with fuzzy boundaries at each end), and the higher the probability of a recent common ancestor.
To find possible relatives, concentrate on runs of 1000 or more SNPs with no opposite homozygous locations.
A half-identical region is described by:

Chromosome number (1-22 or X)
start location
end location
estimated centiMorgan length
number of SNPs observed
names of the two parties being compared.

e.g.

5 149,295,480 169,691,785 27.0 2443 John/Ger

Match list (log in as individual kit number or as project administrator managing several people's kits)
Chromosome browser

False positives can occur - a long half-identical region can by chance consist of short overlapping (or zig-zagging) paternal/paternal, paternal/maternal, maternal/paternal and maternal/maternal segments.

Phasing and triangulation are like opposite sides of the same coin:

If you are half-identical to two people on the same region, where they are not half-identical to each other, then one must match your paternal chromosome and the other must match your maternal chromosome:

phasing is the term used for separating the observed letters into paternal and maternal chromosomes, or separating the observed matches into paternal and maternal relatives.

If you are half-identical to two people on the same region, where they are half-identical to each other, then all three of you must have inherited DNA in that region from a single common ancestor:

triangulation is the term used for identifying three people descended from a common ancestral couple. (More information is usually required to determine whether the shared DNA came from husband or wife in that couple.)

Rule of thumb for lengths of the longest half-identical region::

30 cM+: good chance of finding the common ancestor
20 cM+: worth investigating
10 cM+: probably too distant to trace in surviving Irish genealogical records
under 10cM: possibly half-identical by chance
reduce these thresholds if there is other solid evidence of a relationship
50 cM+ in extreme cases (see below) can still be shared by fourth cousins or even more distant cousins

The aggregate length of all the half-identical regions above some arbitrary threshold is used to estimate the relationship:

1cM threshold for FamilyTreeDNA (provided one segment is 7cM or more)
7cM threshold for GEDmatch

Average autosomal DNA shared by pairs of relatives:

in theory; and
in practice.

Rules of thumb for total shared cM:

over 100cM - closer than 4th cousin;
under 100cM - more distant than 2nd cousin.

over 100cM - use "Shared Centimorgans" to find closest relatives;
under 100cM - use "Longest Block" to find closest relatives.

3rd cousin and closer: typically more than one significant half-identical region
4th cousin and beyond: typically just one significant half-identical region

What can DNA tell us?

With one sample, you can fish for long-lost cousins in three commercial pools and one non-commercial pool (GEDmatch.com).
With two samples, you can confirm or disprove theories about relationships (e.g. Richard III).
It can potentially break through all sorts of genealogical brick walls.
For people with adoptions (or foundlings) in their family history, it may be the only option to find their genetic family; such people are disproportionately represented in all the databases, even compared to the 2% adoption rate in the past.
Those whose genetic ancestry has been concealed from them have a right, and usually a great desire, to know it.
On the other hand, if there is a family secret that you, or others in your family, would like to remain a secret, then genetic genealogy may not be for you.
Ethnicity
- sensitive to the (unspecified) reference population
- distorted by recombination (e.g. 33% rather than 25% from one grandparent)
- "genetic astrology"
- most Irish people are within the margin of error of 100% Irish (or 100% British Isles according to one company)
- great marketing value in the U.S. melting pot
- Genetic Communities
Data-mining, lies, damned lies and statistics

The big 3 DNA companies

New competitors are emerging: Living DNA, MyHeritage
AncestryDNA

Part of ancestry.com
Autosomal DNA only; Very limited analysis tools
Overcharges non-U.S. customers; Full access requires paying ongoing annual subscription
Internal messaging system
Reached 1 million samples in July 2015; 2 million samples in June 2016; 3 million samples in January 2017; Most people use pseudonyms or initials
My results
23andMe: Concentrates on medical aspects of DNA; Autosomal DNA plus predicted Y-DNA and mtDNA haplogroups
Overcharges non-U.S. customers; One-off payment
Optional internal messaging system
About 1 million samples; Most people anonymous; Analysis tools for non-anonymous matches
"Preparation for the transition to the new 23andMe experience" (including doubling of prices) started in October 2015 and still ongoing as of April 2017
Results
Surname View
FamilyTreeDNA (FTDNA): Dedicated to genetic genealogy
Autosomal DNA (Family Finder) plus various Y-DNA and mtDNA products; Good analysis tools; Single worldwide price; One-off payment; No U.S. bias; Simple e-mail communications; 862,717 records as of 3 April 2017; Most people use real names: but married women recommended to use maiden surnames; Projects - e.g. Clare Roots and surname projects
My results

What do you get for your money?

An online list of DNA matches, ordered by closeness of relationship
Regular updates as the database grows
Ethnicity estimates
Raw data to use at third-party websites
Various tools for analysing matches and data
Surname projects (FTDNA only)
Other projects (FTDNA only)

The third-party sites

GEDmatch.com

Whichever of the big three companies you use, you MUST copy your results to GEDmatch.com and persuade your DNA matches to do likewise

for the vastly superior analysis tools; and
for the vastly increased chance of finding someone who will be able to confirm long-forgotten relationships

If the GEDmatch transfer is beyond you or your match, you can also share match lists

by joining an FTDNA project; or
by sharing an AncestryDNA match list: AncestryDNA home, SETTINGS, Sharing DNA results section, INVITE OTHERS TO ACCESS DNA RESULTS, enter Email or Ancestry username, tick Guest button, SEND INVITATION

There is a trade-off between maintaining privacy and finding your long-lost cousins: you must be prepared to give up some privacy if you want to find your relatives.

DNAgedcom.com

featuring ADSA

Levels of involvement

Lists of names: A black box algorithm can be used to list the names of those in a database whose autosomal DNA is closest to yours.; You can look at your matches' own names, their ancestral surnames, ancestral placenames and family trees, if they have made these available.; Anybody can do this.
Lengths of half-identical regions: To get full value from one's investment in DNA analysis, one should move on from the purely qualitative approach of looking at names and take a more quantitative approach.; The first step is to look at the centiMorgan lengths of the regions on which one is half-identical with a potential relative.; The higher this percentage, the closer the relationship is likely to be.; Some basic arithmetic skills are required for this.
Locations of half-identical regions (phasing and triangulation): This may exercise your brain cells a little more than the first two approaches.
Raw data: Sooner or later, the only answer to a particular DNA puzzle will be to look at one's raw data, in the form of long sequences of pairs of As, Cs, Gs and Ts, in order to work out exactly how and why something happened.; This is for the specialist. There are many of us around, willing to help.

Whatever level of involvement you choose, you have a responsibility to provide your DNA matches with at least an outline pedigree chart showing your direct ancestors (FamilyTreeDNA, AncestryDNA).

The easiest way to do this is to upload a GEDCOM file from your desktop genealogy software, e.g. Ancestral Quest.

Example I: The Kellys of Glascloon

How many Thomas Kellys do you know?
How many Thomas Kellys could there have been at the one time in the small townland of Glascloon? 702a 1r 19p; pop. 128 in 1901, 113 in 1911.
I have been trying to answer this question since the pre-DNA days of 2012
One online archival source (Griffith's Valuation) shows that there was no Thomas Kelly listed as occupier in Glascloon in 1855.
Another offline archival source (Kilkee baptismal register) shows that Thomas Kelly and Mary Connors (my GGGgrandmother) of Glascloon had a daughter Honora baptised on 2 July 1838.
Oral tradition, confirmed in the offline Outrage Papers in the National Archives of Ireland, is that Mary Connors's second husband disappeared mysteriously on 20 January 1848.
Clare Journal 3 February 1862
The records of an Irish-speaking population were kept by the Latin-speaking clergy and the English-speaking government bureaucracy.
Nearby Christian names along the spectrum Norah/Nora/Honora/Hanora/Hanoria/Hanna/Hannah/Hanah/Ann/Anne/Johanna/Josie/Josephine/Siobhán/Susan/Judy/Judith/Julia/Sheila/Síle are often interchangeable.
Another Thomas Kelly with Glascloon connections married Mary Green and they were having children baptised in Kilkee parish up to August 1841. The late Albert Greene in Rhode Island wrote down what he knew of this family and passed it on to David Green in Sydney who passed it on to me.
What can DNA add to the conventional genealogical evidence?

We have at least five possible children of one or more Thomas Kellys with possible Glascloon connections:

Honora (above), daughter of Thomas Kelly, chr. 1838
Anne (above), daughter of "the late Mr. Thomas Kelly of Glascloon", m. 1862 (around the time we would expect Honora to marry), to the son of a Kilrush butter merchant
Malachy, son of Thomas Kelly, m. 1867, died in Glascloon in 1879
Bridget, daughter of Thomas Kelly, remarried 1868, also to the son of a Kilrush butter merchant
Nora, grandmother of Bridget's "nieces" from the 1901 and 1911 censuses, m. 1851 (married too early to be Honora)

Whose DNA do we have?

Six descendants of Honora's mother's first marriage (rows 14-19 of matrix spreadsheet)
Two descendants of Anne (rows 7-8)
One descendant of Malachy (AncestryDNA only)
Bridget had no known issue
One descendant of Nora at GEDmatch (row 20) and several others at AncestryDNA and 23andMe
Five relatives of Malachy's reputed mother (rows 9-13)

What do the comparisons tell us?

12 GEDmatch comparisons between Honora's mother's descendants and Anne's descendants, including possible half third cousins: largest shared centiMorgans only 15.1 - inconclusive
2 GEDmatch comparisons between Anne's descendants and Nora's descendants, including possible third cousins once removed: largest shared centiMorgans 33.1 - promising
AncestryDNA comparison between Nora's descendant and Malachy's descendant, possible fourth cousins: shared matches
AncestryDNA comparison between Nora's descendant and Anne's descendant, possible fourth cousins: shared matches
There is a name that none of us had heard before among the shared matches: he has a four-person family tree
His grandparents' marriage fits the missing eldest child of John Egan and Anne Kelly.
And her younger brother Thomas Egan is living with her in the 1900 census of Jersey City (lines 36-40)

So Malachy, Anne, Nora and Bridget must be closely related:

Siblings? Probably
1st cousins? Impossible, as all their fathers are known to be called Thomas
2nd cousins? Much less likely
Different generations? Honora could be their niece: could there have been a Thomas sr. and Thomas jr. fathering children at the same time? Oral tradition is that Honora's father was much younger than the widow whom he married.

Other evidence suggests that there may have been up to 10 Kelly siblings, born about 1816-1841.
Albert Greene's pedigree implies that their mother was Mary Green.
A triangulation involving two of the Kelly descendants and a Green descendant would confirm that the most recent common ancestral couple of the Kellys descendants were Thomas Kelly and Mary Green (see next example).
Finding that triangulation requires getting all the Kelly descendants to copy their results to GEDmatch.com.
If you are not convinced that your theory is correct, just look for one more piece of evidence.

Example II: My Lynch ancestor was Irish - what townland was he from?

Eugene/Owen Lynch was born in "Ireland" around 1869 and died in San Francisco in 1917.
He was grandfather to seven siblings who are all in the DNA databases.
Oral tradition is that an O'Dea farm in Moveen West, County Clare, was divided between two sisters, who married Lynch and Connell respectively, around 1820.
In the Tithe Applotment Book of 17 Nov 1827 for Moyarta parish "Mich'l Lynch 7 Div" occupied a total of 15 Irish acres and two lines below him "Patt Connell 7 Div" occupied a total of 16 Irish acres, the difference being 1 acre of 4th quality land.
In Griffith's Valuation, Mary Lynch née O'Dea had the entire Lynch holding of almost 69 statute acres (no. 9a) but the Connells are omitted.
We have DNA samples from Claire (whose mother was a Lynch) and Ed (whose mother was an O'Connell) and based on this oral tradition they are fourth cousins:
```
8 8,292,285 54,555,905 50.2 10692 Claire/Ed
```
This shared segment, unusually long for fourth cousins, must have come through the two O'Dea sisters.

Claire and Ed triangulate with several of Eugene Lynch's grandchildren, e.g. Michael:

8 17,609,398 38,378,638 27.4 5563 Ed/Michael
8 17,648,866 37,812,773 26.9 5499 Michael/Claire

So, based on the combination of dates with DNA evidence, Eugene must be a grandson of Michael Lynch and Mary O'Dea who married around the early 1820s and whose first names are known from the death certificate of their son Daniel who emigrated to Newtown, Connecticut.
We are lucky that the shared DNA came through a female ancestor and the newly discovered relatives have inherited her husband's surname, so there is no doubt where they fit in the family tree, apart from the first name of Eugene's father.
Five Lynch siblings and one of their children were in Moveen in November 2016.
Their potential second cousin has provided a DNA sample, currently being processed.
Meanwhile other descendants of Michael Lynch and Mary O'Dea have come to light via the DNA databases.
Photo album (for Facebook friends).
"That day was the highlight of our trip to Ireland, and for me it was an unbelievable gift. I have been wondering and imagining for so long about my grandfather's (and thus my own) origins that I still quite can't believe I went there. It was a profound and moving experience for me. My sister Pat and I speak of it often ... It was magical to us. Both of my parents were from families who didn't stay connected with their homeland, and this journey has really fulfilled a need that I hadn't realized I had. I'll be forever grateful to Tom Kearney for introducing me to you, and to you for so generously sharing your expertise with us."

Example III: The Talty millions - did all of those entitled to it get their inheritance?

My greatgrandfather Old Johnnie McNamara was one of the supposed heirs to the Talty Millions in the late 1920s.

In the mid-1860s, Timothy Talty and his wife Margaret (née McNamara) and several children emigrated from Knockanalban in County Clare to Lowell, Massachusetts.
When their youngest child T. J. Talty died in Florida on 1 April 1926, it was believed that his next of kin were his surviving first cousins and children of pre-deceaesd first cousins.
The lawyers got most of the money, and the first cousins that they located got the rest.

But did they find all the first cousins?

Alan recently showed up as my closest unresolved match by largest cM
His matrilineal line went back to Bridget McNam, surely McNamara
Shipping record for Bridget and her husband arriving in NSW on 9 July 1879
One transcription of church marriage record from 28 January 1879
Another transcription
Civil record
In the Talty Millions papers, the authorisation signed by Pat McNamara on 12 June 1926 says `John MacNamara who married ___ Downes of Dunsallagh & lived in her farm at Coor'; Margaret Cunningham's statement of 23 April 1927 says `John Mac'Namara who married Bridget Downes, buried in Kilmurry Ibrickane.'
Could the younger Bridget who went to Australia be their daughter?
Not with her brother Michael in index to Miltown Malbay baptisms
Not with her brother John in index to Kilmurry Ibrickan baptisms
But Bridget McNamara appears to be one of three christenings in Miltown Malbay parish on 16 November 1858
At least two descendants of Michael Downes and Bridget Quinlan also appear among Alan's AncestryDNA matches
Bridget Downes was not born for the 1839 parish census

So I am happy to conclude that Alan is my fourth cousin once removed. And Bridget in Australia (or her daughter, if she had died) was apparently just as entitled to a share in the Talty Millions as her first cousin/my greatgrandfather. But ...

In August 2007, Christiane in Australia began posting queries about her Irish-born ancestor Mary Talty, whose parents are named on her marriage certificate as Timothy Talty and Margaret McNamara.
Did Mary go to Australia on her own before the rest of the family went to Lowell? Or were there two parallel families?
My first cousin Antoin and myself are in Christiane's top four FTDNA matches by longest block, confirming that she is our fourth cousin twice removed, through our McNamara greatgrandfather:
```
9 78,642,927 114,907,097 44.6 9497 Paddy/Antoin
9 85,380,931 103,021,449 21.2 4193 Antoin/Christiane
9 85,856,264 103,021,449 20.9 4120 Christiane/Paddy
```
Christiane's ethnicity is 47% Eastern Europe; 43% Western and Central Europe; 7% Finland and Northern Siberia; 3% Asia Minor; 0% British Isles.
My ethnicity and Antoin's are both 100% British Isles.

Example IV: West Clare ethnicity

FTDNA results appeared on 18 October 2016 for one of my West Clare recruits:

All of his greatgrandparents married before civil registration of Catholic marriages began in 1864.
Seven of his top 30 matches were people that I had met, living in Clare or with Clare roots.
I met an eighth later that day.
I swabbed six of these myself.
Only one is a known relative.

Results like this confirm my statistical theories:

Any two randomly selected Irish people have a 95% chance of being 12th cousins or closer.
Any two randomly selected people from the same Irish county have a 95% chance of being 9th cousins or closer.
Any two randomly selected people from a smaller region within a county are probably even more closely related.
In theory, two fifth cousins have only 10% probablility of being FTDNA-overall-matches.
In practice, one member of the Clare Roots project is an FTDNA-overall match to more than 10% of the other project members.
Does this mean that she is on average more closely related than 5th cousin to everyone in Clare?

We are all descended from Brian Boru, and not just in Thomond.

Conclusion: Why you should submit your DNA

The value of DNA "testing" to genealogists increases dramatically with the number of people from the relevant geographical area and relevant extended family group already in the DNA databases used.
Submitting your DNA to a database has significant positive externalities for existing and future researchers.
We need to persuade more Irish people to submit DNA samples to the databases for purely genealogical purposes.
Your descendants will be eternally grateful to you for leaving them your DNA.