Genetic Genealogy for Beginners

Mayo Genealogy Group

7p.m. Tuesday 5 November 2019

Westport College of Further Education

by Paddy Waldron

WWW version:

http://pwaldron.info/westport/

YouTube version:

TBA

***** NB: FamilyTreeDNA kits will be available after this talk for anyone interested via the DNA Outreach IRL project *****

Outline

• Context
• Definitions
• Components of DNA
• Inheritance paths
• Mutations
• Recombination
• Using the DNA websites
• A case study

Context

• You are the expert on your own family history as you have
• the family's oral traditions in your memory;
• the family papers in your attic, or wherever they are kept; and
• the family DNA in every cell of your body.
• The genealogist's task is to compile family histories by matching up these three categories of private information
• with each other; and
• with public information.
• According to Wikipedia, genetic genealogy is

  the use of Genealogical DNA tests, i.e. DNA profiling and DNA testing in combination with traditional genealogical methods, to infer biological relationships between individuals

• "Testing" does not mean just sending a DNA sample to a laboratory; it means using DNA to test a specific hypothesis derived from traditional genealogical methods.
• The DNA companies are not "testing companies" or "testing laboratories" - they just provide the tools for the genealogist to test his or her own hypotheses.
• The genealogist must organise all the relevant information (oral and paper-based, private and public, traditional and DNA) in an easily searchable lineage-linked computer database format.
• e.g. Ancestral Quest, which I use, or RootsMagic or Reunion or Family Tree Builder or any of the numerous other programs listed on Wikipedia; or even in the "cloud" (if you have superfast broadband and believe that clouds never evaporate, or have a good backup policy).
• The database can be uploaded from time to time to a website if desired, and the part detailing your direct ancestors must be uploaded in conjunction with your DNA data.
• The traditional linear family history narrative that might be published in book format can be:
• generated automatically from the database;
• contained in free-form notes fields within the database; or
• produced as a separate stand-alone end product, using the database as a guide.
• Genealogical records have been created by the actions of our ancestors and of ourselves:
• We are the first generation to create digital records of our DNA.
• The value of DNA comparison to genealogists increases dramatically with the number of people from the relevant geographical area and relevant extended family group already in the DNA databases used.
• See chart and report on database sizes (which does not stress the U.S. bias in most of the databases).
  
• We still need to persuade more known and possible Mayo relatives to submit DNA samples to the databases for purely genealogical purposes.
• Your descendants will be eternally grateful to you for leaving them your DNA.
• Do unto them as you wish your ancestors had done unto you.
• Your own DNA (and especially the DNA of any living parents or grandparents) is one of your most important genealogical sources.
• Deciding not to use your DNA is now the equivalent of deciding not to use census returns.
• DNA has let the genie out of the bottle as regards secret adoptions and fosterings.
• If you want family secrets to remain family secrets, then you need to keep your immediate family members out of DNA comparison databases - including the future children and grandchildren of any unborn children that you desert (see case study below).
• Treat family secrets and those directly involved as sensitively and sympathetically as possible.
• The objectives of this session are to learn how to
• interrogate and extract relevant evidence from your DNA, as you would with any other source; and
• to find hints and leads from the online DNA databases to other surviving sources.
• You will find groups of DNA matches whose most recent common ancestor (MRCA) with you may be just over the present brick walls in your family tree.
• Research has established that people whose ancestors lived close to each other geographically are now themselves close to each other genetically.
• The converse is not necessarily true: people from Place A may share DNA with people from Place B, but their most recent common ancestors may have lived in Place C.
  
• The correlation between genes and geography allows the DNA companies to peddle estimated ethnicity percentages, almost inevitably presented without any mention of the associated margin of error.
• The DNA companies are still looking for GAA people (people with Geographically Anchored Ancestry) to form reference populations and provide improved estimates.
  
• FamilyTreeDNA.com hosts three types of DNA projects, co-administered by people like me:
• geographically-based, e.g.:
• Clare Roots (co-administator Terry Fitzgerald, WA, USA; 1373 members as of 3 November 2019)
• Kerry Y-DNA Project (administrator John Hallissey, Waterford; 96 members)
• surname-based, e.g.:
• Clancy (administrator Fergus Clancy, Dublin; 98 members)
• Durkin/Durkan/Durcan (administrator Mike Durkin, NY, USA; 32 members)
• Marrinan (administrators Cory Marinan, WI, USA; Cindy Wood, MI, USA; Greg Marrinan, CT, USA; 64 members)
• McNamara (rescued from worldfamilies.net and GDPR; 115 members)
• O'Dea/O'Day/Dee (administrator James O Dea, Dublin; 110 members)
• haplogroup-based, e.g.:
• R-M222 and Subclades (Irish Type I) (2663 members)
• R1b-CTS4466 Plus (Irish Type II) (985 members)
• R-L226: The Irish Type III cluster (707 members, including some of the Clancys, McNamaras and O'Deas)

Definitions

Components of DNA

• What is DNA?
  • short for deoxyribonucleic acid
  • made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
  • represented by strings of the letters A, C, G and T
  • DNA labs turn saliva or cheek swabs into data files of As, Cs, Gs and Ts:

    RSID	CHROMOSOME	POSITION	RESULT
    rs4477212	1	72017	AA
    rs3094315	1	742429	--
    rs3131972	1	742584	GG
    rs12562034	1	758311	--
    rs12124819	1	766409	--
    rs11240777	1	788822	AG
    rs6681049	1	789870	--
    rs4970383	1	828418	CC
    rs4475691	1	836671	CC
    rs7537756	1	844113	AA

  • these data  files can be copied to other DNA comparison websites
• Where does our DNA come from?
  • DNA is inherited by every child from his or her parents,
  • largely deterministically, but with
  • enough random variation over hundreds of thousands of years to result in wide variations in the DNA signatures observed  today.
  • When a sperm fertilises an egg, each brings DNA, which is replicated in every cell of the resulting person.

Inheritance paths

Y chromosome

Only males have a Y chromosome.
Y-DNA comes down the patrilineal line - from father, father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.

X chromosome

Males have one X chromosome, females have two.
X-DNA may come through any ancestral line that does not contain two consecutive males.
Blaine Bettinger's colour-coded blank fan-style pedigree charts show the ancestors from whom men and women can potentially inherit X-DNA.

Autosomes

Short for autosomal chromosomes

Exactly 50% of autosomal DNA (atDNA) comes from the father and exactly 50% comes from the mother.
Due to recombination, on average 25% comes from each grandparent, on average 12.5% comes from each greatgrandparent, and so on.

In extreme cases, an individual can inherit up to 35% from one paternal grandparent and, hence, as little as 15% from the other paternal grandparent.
Siblings each inherit 50% of their parents' autosomal DNA, but not the same 50% (except for identical twins).
Similarly, siblings each inherit 50% of their mother's X-DNA, but not the same 50% (except for identical twins).
Sisters each inherit 100% of their father's X-DNA.

Mitochondria

Everyone has mitochondrial DNA (mtDNA).

Mitochondrial DNA comes down the matrilineal line - from mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.

• In general, genealogists pay the DNA laboratories separately to use different machines to extract data files from the different components of the DNA.
• Autosomal DNA is the cheapest component to analyse and has rapidly become the most widely used in genealogy.
• Y-DNA has been widely used for one name studies or surname projects for much longer, but has also seen rapid recent scientific advances.
• Targeted mitochondrial DNA and X-DNA comparisons can be used to solve more specialised problems.

Mutations

• Short Tandem Repeat (STR): a string of letters consisting of the same short substring repeated several times, for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be repeated less or more often in other individuals.
• Single Nucleotide Polymorphism (SNP): a single location where two (or occasionally more than two) different letters are observed in different individuals.

Y-DNA Mutations

• The Y chromosome is passed virtually unchanged from father to son.
• Early Y-DNA analysis looked at the numbers of repeats for each of 12 STR markers on the Y chromosome.
• Now Surname Projects look at 37, 67 or 111 STRs.
• The state-of-the-art Big Y-700 product reports values for 700+ STRs.
• Genetic distance between two men is, roughly speaking, the number of differences between their STR signatures, e.g. 0/12 or 9/111.
• The smaller the genetic distance between two men, the closer their expected relationship.
• The correlation between genetic distance and degree of relationship is not perfect:
• When an STR mutation occurs, the subject of the mutation is genetic distance 1/37 (say) from his father;
• until the next STR mutation occurs, all descendants of the subject of the mutation are genetic distance 0/37 from their most recent common ancestor.
• Two men are declared to be Y-STR matches by FTDNA if the genetic distance between them is 4/37, 7/67 or 10/111 or closer.
• The four Durk*ns in the surname project with Y-DNA111 results are between 3/111 and 11/111 from each other, so must have a common Durkan ancestor.
• Many surnames are found to have multiple genetic origins, due to:
• independent adoption of the surname by unrelated individuals at the start of the surname era; or
• subsequent surname/DNA switches:
• DNA from the genetic father
• surname from mother/stepfather/mother's husband/clan chieftain/benefactor/etc.
• Some SNP mutations on the Y chromosome are once-in-the-history-of-mankind events and can be used to build a Y-DNA Haplotree, which has evolved from the original Simplified Tree of Y-Chromosome Haplogroups (top level haplogroups A-R are about 20,000 years old).
• The Durkan SNP mutations are shared with other surnames.
• Surname-specific SNPs are now being discovered.
  

Autosomal DNA Mutations

• The DNA companies observe only 0.02% or so of the 2,865,561,399 locations on the autosomes
• The locations observed are the locations known to have SNP mutations.

Recombination

• Every sperm and egg is potentially unique.
• Recombination of the paternal and maternal chromosomes is sometimes compared to shuffling two decks of playing cards.
• Recombination rates vary markedly along the autosomes and the X chromosome.
• The local recombination rate is referred to as genetic length and is measured in units called centiMorgans, which estimate the number of generations to the common ancestor of two individuals sharing an identical long run of letters.
• One recombination per generation is expected in each 100 centiMorgans (cM, not cm).
• The greater the genetic length of the DNA shared by two individuals, the closer the expected relationship.
• The correlation between shared centiMorgans and degree of relationship is not perfect.
• Two people are declared to be autosomal matches by the DNA companies if their shared centiMorgans exceed company-specific thresholds
• See TheDNAgeek chart and the Shared cM Project chart and tool 

Using the DNA websites

• comparison table
• GEDmatch.com
• FamilyTreeDNA.com
• AncestryDNA
• MyHeritage.com

To add your genealogy information to the online DNA databases:

• Export a GEDCOM file containing at least the ancestors of each DNA subject and upload it to all the DNA websites so that matches can see a pedigree chart.
• Examples of pedigree charts: from Ancestral Quest, AncestryDNA, ancestry.com, FamilyTreeDNA and GEDmatch.
• For FamilyTreeDNA.com, include in the GEDCOM file any third cousins or closer already at FTDNA and the shared ancestors; FTDNA will use these linked relationships to assign other matches to the DNA subject's paternal and maternal sides (example).

GEDmatch.com tools

• User Registration
• Generic Uploads (23andme, FTDNA, AncestryDNA, most others) (DNA data)
• Upload GEDCOM (Fast)
• One-To-Many DNA Comparison Result
• One-to-One Autosomal DNA Comparison
• People who match both, or 1 of 2 kits
• Are your parents related? (e.g. T409076)
• Multi Kit Analysis
• Autosomal DNA comparison matrix (see case study below).
• Tier 1 Utilities
• Segment Search
• Lazarus
• etc.
• etc.

FamilyTreeDNA.com tools

• Dashboard
• Matches
• Chromosome Browser
• Download Raw Data Build 37 Concatenated Raw Data (bottom right)

AncestryDNA tools

• Test Settings
• Family Tree Linking
• Download Raw DNA Data
• Share your match list (+ Add a person)
• Match list
• Search Matches (by surname or by birth location, if available on the dropdown)
• search results appear incomplete for new kits
• Match page
• Shared Matches

Reveal the DNA subject's birth surname:

Most people inherit DNA with their birth surname, so identify yourself as a minimum by your birth surname with an initial or a title, e.g., P Waldron or Mr Waldron or Miss Durkan.

Reveal the gender of the person who provided the DNA sample:

Valuable additional inferences can potentially be drawn once it is known whether two X chromosomes (female) or one X chromosome and one Y chromosome (male) are potentially available for comparison.
Women do not have Y-DNA and are encouraged to recruit their male relatives to provide Y-DNA, but they must NOT attach a female name to a male DNA sample, as this causes untold confusion.
Be especially careful not to inadvertently link a male's Y-DNA results with a female's autosomal DNA results at FamilyTreeDNA.com where error-checking does not look for this.
Also take care not to link a male DNA sample to a female's pedigree chart (or vice versa).

Avoid providing irrelevant information:

Your first name, married surname, adopted surname or marital status reveal nothing about your DNA, so you may keep these private if you wish.

Avoid pseudonyms:

They reduce the chances that your matches will bother to look at your family tree, contact you or share the information about your ancestry that they have and that you do not have.

Keep all your DNA-related correspondence in a single searchable e-mail archive

Use the internal messaging system and AncestryDNA/MyHeritage/23andMe or Facebook messages only to exchange e-mail addresses.

A case study: the Lynches of Moveen West

Episode 1

• Background:
• The Hills of Moveen  have become the Cliffs of Dooneen in a popular song - see Facebook discussion.
• Pádraig Máire Neans (b. Abt 1826/9, d. 1907) and Tomás Máire Neans (b. Abt 1838/41, d. 1921) are remembered in the oral tradition as two Lynch brothers living across the road from each other in Moveen West. 
• They survived the Great Famine in Moveen.
• Their mother Máire is remembered as one of two sisters between whom an O'Dea farm was divided - Mrs Lynch and Mrs O'Connell.
• In Griffith's Valuation in 1855, Mary Lynch (no. 9, apparently widowed) and Patrick Lynch (no. 24, recently married) are listed as occupiers.
• A third Lynch brother, Daniel, went to Connecticut, where his death certificate confirms his parents' full names:

  Daniel Lynch, Newtown, Aug 4, 62, male, married, County Clare, Ireland, Newtown Conn, Paralysis Caused by fall, Farmer, W, Michael Lynch, Mary O'Day, Albert L Schuyler MD
  [3rd last line on each page]

• Daniel is buried in St. Rose's Cemetery in Sandy Hook.
• 20 June 2016: Donation from the diaspora to Clare Roots project "to go towards the test cost for a descendant of the Moveen West Lynch families".
• Around the same time, the Lynch siblings of Sacramento began to show up as autosomal DNA matches to "all the usual suspects" - people with roots on the Loop Head peninsula in West Clare.
• What they then knew about their Irish-born grandfather:

  Because our grandfather, Eugene Lynch, is such a mystery to us we really don't know how to find him. All we have for certain is the 1910 census [lines 39-43]. It says he came over in 1887. The story is this: Eugene married my grandmother in San Jose in 1904 and they lived in Sacramento. He abandoned her and their children in 1909 [sic] when my grandmother was pregnant with my father. We didn't really know anything about him until we started doing this genealogy. We knew [sic] he died in San Francisco in 1917 but were surprised to discover that he was the captain of a schooner at the time.

• 6 October 2016: I uploaded the new recruit to GEDmatch.com and found this triangulation:

  8 8,292,285 54,555,905 50.2 10692 Claire/Ed
  8 17,609,398 38,378,638 27.4 5563 Ed/Michael
  8 17,648,866 37,812,773 26.9 5499 Michael/Claire

• Claire and Ed are fourth cousins, descended from Mrs Lynch and Mrs O'Connell respectively.
• So their 50.2 centiMorgan half-identical region must contain an O'Dea segment.
• Michael is Eugene Lynch's grandson, and must be related to Mr O'Dea (first name still unknown) or Mrs O'Dea (Neans) or descend from both.
• Michael's surname is Lynch, so he and Eugene must descend from Michael Lynch and Mary O'Dea.
• Eugene (41 in 1910, migrated 1887) is too young to be Michael and Mary's son (their known children have implied birth years 1824-1841).
• Eugene's baptism is not the parish registers, which survive from 1852.
• Eugene's descendants share too much DNA with other descendants of Michael Lynch and Mary O'Dea for him to be their greatgrandson.
• So he must be their grandson.
• Even this implies a somewhat implausibly large 209.5cM shared between 3C1R - see Autosomal Matrix Comparison and Table of Probabilities.
• 15 November 2016: The Sacramento Lynches arrive in Moveen:

  That day was the highlight of our trip to Ireland, and for me it was an unbelievable gift. I have been wondering and imagining for so long about my grandfather's (and thus my own) origins that I still quite can't believe I went there. It was a profound and moving experience for me. My sister Pat and I speak of it often ... It was magical to us. Both of my parents were from families who didn't stay connected with their homeland, and this journey has really fulfilled a need that I hadn't realized I had. I'll be forever grateful to Tom Kearney for introducing me to you, and to you for so generously sharing your expertise with us.

• For over two years, we swabbed various descendants of four known sons of Michael Lynch and Mary O'Dea in search of closer matches and of further clues, but failed to identify Eugene Lynch's father.
• Where was the fifth Lynch sibling (Eugene's parent) hiding from us?

Episode 2

• 8 March 2019: The Sacramento Lynches return to Moveen (Facebook post).
• An epiphany on the road to Kilkee - a new hypothesis to be tested: Could Eugene have taken his mother's surname?
• No sign of a Eugene Lynch born to a single mother in the local workhouse.
• We have analysed autosomal DNA matches extensively, but did we ever check Michael Lynch's Y-DNA STR matches?
• The Y-DNA and the surname both follow the male line, unless there is a surname/DNA switch.
• Not a Lynch to be seen in Michael's matches
• Two Currys out of nine Y-DNA111 matches.
• Four more Coreys or Currys (including an adoptee), none of whom has bought Y-DNA111,  in his top 12 Y-DNA67 matches.
• Surname spellings also mutate, independently of DNA mutations.
• Corey, Corry, Curry, O'Curry, Ó Comhraí should all have the same Y-DNA signature; likewise Lynch, Lindsey, Lynskey, Lynchahaun, Lynchaghaun, etc.
• Could Eugene Lynch really be another Eugene O'Curry?
• Not the parent expected? (NPE)
• The DNA evidence often fills gaps in the traditional evidence, but sometimes refutes it.
• His famous namesake reputedly descends from the O'Currys of Lisluinaghan (see partly evaporated Rootsweb post).
• The Mary Lynch who married Thomas Corry/Curry of Lisluinaghan appears to have been a daughter of Michael Lynch and Mary O'Dea:
• 98.5 centiMorgans shared between a descendant of Daniel Lynch and a descendant of Mary Curry, who could be no closer than 3C1R;
• Pat Corry from Lisluinaghan witnessed the shotgun wedding of Michael Lynch of Moveen in 1882 - were they first cousins? Or even double first cousins?
• Thomas Curry and Mary Lynch had a youngest son called Eugene/Owen:
• baptised in Kilkee parish on 10 Apr 1866;
• 1887 copy book;
• photographed in Danbury, CT;
• "this ancestor has been very elusive";
• he had "previous";
• no sign of Eugene Curry in 1900;
• his wife Ellen Curry née Kelly (a neighbour from home) was a live-in servant in Brooklyn (line 48);
• Ellen's sister Mrs Margaret Blomberg was taking care of Eugene and Ellen's daughter Margaret in Brooklyn also (line 93);
• Eugene's brother Simon Corey was taking care of Eugene and Ellen's daughter Elsie in Newtown, CT (line 96);
• the family lore passed down has always been that "Eugene Curry `went west' to find his fame and fortune and would send for his family at a later date.  He was never heard from again" (until 2019!)
• "The idea of the two Eugenes being one is a bit staggering and mind-boggling" for his descendants, and even for me.
• The Curry/Kelly descendant remains sceptical, both about using DNA and about her ancestor's double life.

• 209.5cM shared between 2C1R makes a lot more sense than 209.5cM shared between 3C1R.
• A significant DNA match had a biggest estimated ethnicity percentage labelled "West African":
• she eventually revealed one tiny clue, that her grandfather came from Kilfearagh townland
• Thomas Corry and Mary Lynch had one granddaughter who married into Kilfearagh
• local enquiries confirmed that her granddaughter in turn married a black man
• Another significant DNA match asked to meet us in Dublin, and:
• turned out to be an adoptee
• had never met any blood relatives before the Lynches
• had been given "non-identifying" information about the birth father: "a teacher named ..."
• there was one obvious candidate, now deceased, among the many descendants of Thomas Corry and Mary Lynch, consistent with the DNA evidence
• the adoptee's aunt had been waiting for 40 years for the phone call which resulted
• the adoptee has been introducted to a half-sister, and the relationship confirmed by DNA comparison
• this accidental corollary of the search for Eugene Lynch is yet more evidence that submitting your DNA to a database has significant positive externalities for existing and future researchers.
• Michael Lynch's Big Y-700 SNP results
• Thomas Lynch's Y-DNA37 STR results
• Thomas's only match had waited patiently from 6 March 2012 until 17 April 2019 for his first match
• He wrote:

  We could trace our roots from the time [my great grandfather Thomas Lynch] landed in New York state in the early 1850s; before that, we have nothing solid. Family folklore has it that his parents were a Michael and Mary in Ireland. A bit of searching I tried to do while I was in Ireland some time ago led nowhere, so this news is encouraging.

• This emigrant Thomas was a contemporary of his namesake Tomás Máire Neans who remained in Moveen, but they were possibly closely related.
• The descendants of Mary Lynch née O'Dea (d. 11 Dec 1885 aged 84) and Kate O'Connell née O'Dea (d. 13 Jan 1889 aged 78) have many matches with descendants of Anne O'Dea (d. 28 Mar 1901 aged 84), who lived and died in the adjoining townland of Lisheenfurroor, and who is almost certainly a third sister.
• We need to persuade additional O'Dea descendants to copy their results to GEDmatch so that we can add them to the Autosomal Matrix Comparison.
  

Further reading

• See here for all the technical details of how and why to upload your DNA data and pedigree charts to the various websites.
• A Beginner's Adventures in Genetic Genealogy
• Facebook groups:
  
  • ISOGG
  • Irish DNA
  • Genetic Genealogy Ireland
  • Genetic Genealogy Tips & Techniques
• Bloggers:
  
  • Genetic Genealogy Ireland (Maurice Gleeson)
  • The DNA Geek (Leah Larkin)
  • Musings on Genealogy, Genetics, and Gardening (Kitty Cooper)
  • All My Foreparents (Israel Pikholz)
• ISOGG Wiki
• GGI YouTube channel