Creating a Y DNA Project

Galway Genetic Genealogy Conference

10:20 a.m. Saturday 4 May 2019

Holy Rosary College, Mountbellew, County Galway

by Paddy Waldron

WWW version:

http://pwaldron.info/Mountbellew/2019/

YouTube version:

TBA

Introduction

• estimating the relationship between two men with the same or similar surnames; and/or
• finding new male line relatives or "Y-DNA matches".

• DNA is:
• made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
• represented by strings of the letters A, C, G and T
  
• The Y chromosome, like the surname, is passed virtually unchanged from father to son, with just occasional mutations.
• There are 59,373,566 letters on the Y chromosome alone.
• Over tens of thousands of years, these occasional mutations add up to give a wide distribution of different Y-DNA signatures today.
• Only males have a Y chromosome for comparison.
• The Y chromosome comes down the patrilineal line - from father, father's father, father's father's father, etc.
• This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.
• A woman does not have a Y chromosome, so should find a male relative with the relevant surname to swab:
  • a father, brother, nephew, cousin, etc., if her interest is in her maiden surname; or
  • a husband, son, brother-in-law, father-in-law, etc., if she is married and her interest is in her married surname.
• A single mother who has given her maiden surname to her son has performed a surname/DNA switch; so her son's Y-DNA reflects his father's surname, and not his own surname.

• A single-nucleotide polymorphism, abbreviated SNP and pronounced snip, is a single location where there is a relatively high degree of variation between different people.
• For example, most people may have an A at one such location, with a minority having a C.
• A short tandem repeat (STR) is a string of letters consisting of the same short substring repeated several times, for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times.
• The number of repeats may occasionally differ between parent and child, due to mutations.

• By far the most comprehensive Y-DNA service is provided by FamilyTreeDNA.com (FTDNA), but there are competitors like YFull.com and YSEQ.
• FTDNA sells Y-DNA12, Y-DNA37, Y-DNA67, Y-DNA111, etc., which compare the number of repeats in 12, 37, 67 or 111 STRs respectively.
• My Y-DNA111 matches as of 11 February 2019.
• My top Y-DNA67 matches as of 11 February 2019.
• These numbers are used to assign men to predicted haplogroups.
• The word haplogroup has long been used to describe any group of men with similar Y-DNA; its meaning has evolved with the science of analysing the Y chromosome.
• The numbers of STR repeats and predicted haplogroups can be viewed in the Y-DNA results pages for various projects, such as the Clare Roots project.

• These mutations have occurred exactly once.
• Every man descended from the man in whom the mutation originally occurred inherits the mutation.
• No other man has the mutation.
• Men with the same SNP mutation tend to also have similar patterns of STR mutations, so STR mutations are used to predict SNP mutations.

• did their most recent common male line ancestor use the same surname, or a variant of it?
• did their most recent common male line ancestor live within the surname era (post-1014), but use a different surname?
• approximately when did their most recent common male line ancestor live?
• approximately when did a man in the relevant male line first adopt the present surname?
• do they have a more recent common male line ancestor than genetic Adam?
• The "biblical Adam" was the first and only male in the world at the time of creation.
• The "genetic Adam" or "Y-Adam", the most recent common patrilineal ancestor of all men alive today, was merely the only male in the world in his day whose male line descendants have not yet died out.
• Y-Adam is estimated to have lived between 160,000 and 300,000 years ago.
• are the men being compared from the same ancient haplogroup?
• are they from the same recent haplogroup?
• has there been a surname/DNA switch since their ancestors first adopted surnames?

Outline

• Joining FTDNA
• Joining projects
• Becoming a co-administrator
• Application procedure
• Project objectives
• Administration tools
• Examples

Joining FTDNA

• If you have autosomal DNA data with another company, then you should join FTDNA via the free autosomal transfer facility.
• If you (or a deceased relative) have already sent cheek swabs to FamilyTreeDNA for Family Finder or mitochondrial analysis, then they are held in storage and will be re-used for Y-DNA analysis.
• If you are completely new to genetic genealogy, then swab kits are available here today.
• If you want the best price, join one of the existing Surname & Geographical Projects before placing your order.
• There may be no other man of your surname in the FTDNA database (e.g. no Geheran in February 2019, although there is a Palmer with Geheran DNA).
• There may be only a few people of your surname in the FTDNA database (e.g. there were only 11 Dungans of either gender in February 2018, rising to 16 by February 2019).

Joining projects

• surname-based (e.g. O'Dea)
• geography-based (e.g. Clare Roots)
• haplogroup-based (e.g. R-L226)

• you may be introduced to relatives who are just outside the FTDNA matching thresholds (4/37, 7/67, 10/111)
• you will contribute to the advancement of knowledge about your own surname, about related surnames, and about Y-DNA

Becoming a co-administrator

• Good succession planning recommends that every project should have at least two administrators or co-administrators.
• If you offer to help with one of your existing projects, then the existing administrator(s) may train you in.
• The first prerequisite (thanks to GDPR) is to have an e-mail address which you are prepared to expose to spammers and to other non-FTDNA customers:
  • You may already receive more e-mails than you have time to read or reply to.
  • You may wish to establish a new e-mail address specifically for this purpose.
  • Wikipedia defines a data breach as "the intentional or unintentional release of secure or private/confidential information to an untrusted environment".
  • My long-standing guidelines on e-mail etiquette demand that my correspondents "please do not publish my e-mail address on any web page, news group, chat room, etc."
  • If you are an ordinary customer of FTDNA, only your matches can see your e-mail address.
  • If you are an FTDNA project administrator, everyone on the internet, whether an FTDNA customer or not, sees your e-mail address.
  • This is part of the FTDNA Terms & Policies.

Application procedure

Project objectives

• determine the branch (single genetic origin) or branches (multiple genetic origins) of the haplotree to which the surname belongs
• recruit project members:
• FTDNA will send an e-mail on behalf of an administrator, no more than once every six months, to all customers with the relevant surname who have opted to receive such e-mails.
• Administrators can see project members' matches and can e-mail those matches directly to invite them to join.
• Other online and offline recruitment drives are possible.
• There may already be a relevant surname organisation.
• Organisations like Clans of Ireland or GOONS may be willing to help.
• predict SNP mutations and recommend haplogroup projects:
• FTDNA uses STR mutations to predict SNP mutations.
• Most Irish men are very confidently predicted by FTDNA to be R-M269+.
• FTDNA does not predict more recent SNPs.
• Project administrators can often confidently predict more recent European SNPs like R-U106 or R-P312 or more recent Irish SNPs like R-M222 (Niall of the Nine Hostages) or R-L226 (Dalcassian).
• overlay trees on each other:
• surname trees from the ancient annals
• SNP haplotree
• mutation history trees, combining SNPs and STRs
• genealogical trees
• maintain the Y-DNA Colorized Chart:
• Subgroups are sorted alphabetically on the results pages, so bear this in mind when choosing names
• Criteria for grouping can include:
• surname
• geography
• haplotree position, whether
• confirmed by FTDNA
• predicted by FTDNA
• predicted by project administrator
• desire to see STR differences highlighted
• Many of the colours available for distinguishing subgroups don't work very well, or at least my eyesight isn't good enough to use them, as the background colours are too close to the text colour.
• I use this colour scheme in most of my projects:
  
• Each top-level haplogroup represented in the project has its own colour, so far comprising:
  • E (Lime)
  • G (Light Blue)
  • I (Beige)
  • J (Aqua Marine)
  • Q (White)
  • R (Light Grey)
• Within haplogroup R, there are also separate colours for sub-branches:
• R1a (Pink)
• the four main Irish sub-branches:
• R-M222 (Green Yellow) is North West Irish/Irish Type I and subclades
• R-CTS4466 (Plum) is South Irish/Irish Type II and subclades
• R-L226 (Coral) is Dalcassian/Irish Type III and subclades
• R-L362 (Orchid) is Munster Type I and subclades
• the rest of R-L21 (Yellow)
• R-U106 and subclades (Light Cyan)
• act as moderator of the activity feed
• advise members on purchasing upgrades:
• single SNP tests (USD39)
• additonal STRs
• SNP packs
• Big Y-700 (USD649)
• discover new surname-specific SNP mutations and get them added to the haplotree
• advise members on using the FTDNA website and other databases, tools and websites, e.g.:
• The Big Tree
• instructions
• L226 branch
• M222 branch
• genesis.GEDmatch.com
• Facebook groups, e.g.
• Galway Genealogy DNA
• Mountbellew PLU DNA & Genealogy

Administration tools

• the public website editor, which can be used to publish information under any or all of the following headings:
• Background
• Goals
• News
• Updates
• Bulletin
• Results
• Code of Conduct
• FAQ
• the Y-DNA genetic distance calculator:
• this has greater thresholds than the matching algorithm: 7/37 instead of 4/37; 25/67 instead of 7/67 and 40/111 instead of 10/111
• examples: R-M222 for a man with one Y-DNA37 match with no SNP test; R-FGC29367 for a man with no Y-DNA111 match.
• the subgroup editor to arrange members on the Y-DNA results pages
• Subgroup Names (which are visible on the results pages) appear to be truncated at 161 characters, without warning. So keep these names as short as possible with no unnecessary spacing or punctuation.
• Subgroup Descriptions (which are visible to the project administrator(s) only) appear to be truncated at 973 characters, without warning, and despite the false assurance of scroll bars in the editor.

Examples

1. Mr Clancy
• 15 STR matches at genetic distance 3/37 and 4/37
• none of them is a Clancy
• only one has bought Big Y, and he is R-A933+/R-A934+
• Was the man who adopted the Clancy surname R-A933+/R-A934+?
• three other members of the Clancy project are R-A933+
• they are all more than 7/37 from the new Mr Clancy
• I recommended the single SNP test for R-A933
• it came back positive
• Are there Clancy-specific SNPs below R-A933 on the haplotree?
• two project members did Big Y and are R-BY81149+ and R-BY120940+
• the other project member did two single SNP tests and is R-BY81149- and R-BY120940-
• so these appear to be Clancy-specific SNPs, or mutations which occurred after adoption of the surname
• Are these two separate branches of the tree, descended from the first Clancy?
• Or could there be two independent genetic origins of the surname, both under R-A933?
• There are certainly several independent genetic and geographic origins of Clancy:
• Leitrim
• north-west Clare (Corcomroe)
• south-east Clare (Tradaree)
2. Mr Lynch
• Ordered Y-DNA37 on 2 Dec 2011.
• Kit back 25 Jan 2012.
• Processing completed 6 Mar 2012.
• First Y-DNA37 match appeared 17 Apr 2019 - another Lynch, with roots in Moveen, County Clare.
• Was it worth the seven-year wait?!
• The first Moveen Lynch that I recruited to the Clare Roots project turned out to be the grandson of a (bigamous) Curry who did a surname/DNA switch, from his father's surname to his mother's surname.
• I recently recruited his Lynch 3C1R to confirm this.
• This had a positive externality for Mr Lynch.
• A Google search enabled me to trace his lineage back to a Lynch whose obituary confirmed that he migrated from County Clare to Winona County, Minnesota.
• I e-mailed Mr Lynch and recruited him to the Clare Roots project.
• He is 5/37 from a Lindsey in that project.
• Lindsey and Lynches clearly were both originally Ó Loinsigh in the Irish language, but the ancestors of the DNA subjects anglicised the name differently.
• Lindsey has already bought the top-of-the-range Big Y-700 product, which gives him a terminal SNP of DC269.
• Note that DC is short for Dalcassian, and all DCxxxx SNPs are below R-L226 on the haplotree.
• I (or FamilyTreeDNA) should have already recognised the telltale signs that the two Lynches are Dalcassians.
• These signs are four values in the first 37 markers, and both Lynches have all of them:
  
  • DYS 439 = 11    Yes
  • DYS 459 = 8-9    Yes
  • DYS 464 = 13-13-15-17    Yes
  • DYS 456 = 15    Yes
• The DYS458 STR marker is highly volatile in the Lynch/Lindsey family, accounting for their lack of matches and the large genetic distance between them.
• For Lindsey its value is 17; for the two Lynches it is 20 and 22.
• I predict that the Lynches are also very likely to belong to the R-DC269+ branch of the haplotree.
• An Ireland Reaching Out discussion led me to another Lynch researcher with connections to Moveen and Winona County who filled in more blanks in the tree.