The Clans of County Clare: Combining
archives, annals and Y-DNA
3:00 p.m. Thursday 17 May 2018
Abbeycourt Suite, Great National Abbeycourt Hotel, Nenagh,
Co. Tipperary
WWW version:
YouTube version:
TBA
Introduction
- Modern archives (census returns, civil registration, etc.) are used
by genealogists to verify the oral family traditions passed down from
their older relatives.
- The ancient annals of Ireland contain details of the
original bearers of many surnames and the relationships between them,
but are they just unverified traditions passed down orally for many
centuries before they were committed to writing?
- All surname groups are now using DNA for family research
and for verification (or refutation) of the annals.
- DNA (short for deoxyribonucleic
acid) is:
- inherited by all living organisms from their parents;
- made up of chromosomes and mitochondria, each consisting
of
molecules of four nucleotides
named adenine (A), cytosine (C), guanine (G) and
thymine
(T);
- represented by strings of the letters A, C, G and T.
Where does our Human DNA come from?
- When a sperm fertilises an egg, each brings DNA, which is
replicated in every cell of the resulting person.
|
male
offspring |
female
offspring |
sperm |
Y chromosome |
X chromosome |
22 paternal autosomes |
egg |
X chromosome |
22 maternal autosomes |
mitochondria |
- autosome
is short for autosomal chromosome.
Inheritance Paths
- Y chromosome
- Only males have a Y chromosome.
The Y chromosome comes down the patrilineal line - from father,
father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of
arms, peerages, etc.
- X chromosome
- Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not contain two
consecutive males.
Blaine Bettinger's nice
colour-coded blank fan-style pedigree
charts show the
ancestors from whom men and women can potentially inherit
X-DNA.
- Autosomes
- Exactly 50% of autosomal DNA comes from the father and
exactly 50% comes from the mother.
Due to recombination, on
average 25% comes from each
grandparent, on average
12.5% comes from each greatgrandparent, and so
on.
Siblings each inherit 50% of their parents'
autosomal DNA, but not the same 50% (except for identical twins).
- Mitochondria
- Everyone has mitochondrial DNA.
- Mitochondrial DNA comes down the matrilineal line - from
mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.
- Y
DNA from males is widely used for one name studies or surname projects
such as the O'Dea/O'Day/Dee DNA Project or
geographical projects such as the Clare Roots Project hosted
by FamilyTreeDNA.com.
- Autosomal DNA comparison is heavily marketed to males and
females by several companies including AncestryDNA.
- Targeted mitochondrial DNA comparisons can be
used to address
more specialised
problems - e.g. did two women have the same mother? or just come from
the same female line?
- Targeted X DNA comparisons can also be
used to solve
more specialised
problems - e.g. did two men have the same mother?
As this is a Clans and Surnames event, this talk will concentrate on Y
DNA, which is associated with surnames.
Mutations: STRs, SNPs and Haplogroups
Most DNA is transcribed exactly from the relevant parent to the child.
Mutations
are transcription errors at single locations, e.g. a single A in the
parent may be replaced by a C in the child.
Some locations mutate very frequently (every couple of generations),
and can be used to identify
individuals beyond reasonable doubt, e.g. in criminal cases.
Some locations mutate less frequently (only once in many generations or
once in the history of mankind), and can be used to identify
closely or distantly related individuals.
Special types of mutations:
- Short Tandem Repeat (STR): a string of
letters consisting of the
same short substring repeated several times, for example
CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be
repeated less or more often in other individuals.
- Single Nucleotide Polymorphism (SNP): a single location
where two (or occasionally more than two) different letters are
observed in different
individuals.
FamilyTreeDNA will (for a fee)
examine your Y chromosome (if you have one) for both STR and SNP
mutations.
STR mutations can reverse or repeat in later generations, but some SNP
mutations on the Y chromosome are once-in-the-history-of-mankind
events.
These mutations have occurred exactly once. Every man
descended from the man in whom the mutation originally occurred
inherits the mutation. No other man has the mutation. When discovered,
each of these SNPs is given a label consisting of letters followed by
numbers, occasionally including an underscore (_), e.g. L226 or FGC5660
or ZZ33_1.
Men with a more recent SNP may share older SNPs with men who don't have
the recent one.
Note that surname spellings also mutate, independently of DNA
mutations, e.g. Ó Deaghaidh to O'Dea to O'Day.
The Pros and Cons of Public DNA Comparison
- There is a trade-off between:
- increasing your chances of proving your relationship to
long-lost cousins and ancestors (and being found by long-lost cousins);
and
- maintaining the privacy of your family history research
and DNA results.
- If you keep your DNA
results or known family tree private, then nobody will be able to find
you and you will not
be able to find any DNA matches.
- If you want to be found, then you must
let your potential cousins see your DNA results and the relevant part
of your known family
tree (i.e.
the.ancestors from whom you may have inherited your DNA).
- Some customers of the DNA companies appear to wish to
maintain a
certain degree of privacy and anonymity.
- Others find it paradoxical that
those trying to identify their anonymous ancestors can be so concerned
about anonymising their own identity.
- Do you want your descendants cursing you in perpetuity for
trying to hide from them?
- If there was a mass murderer in your extended family, would
you object to your DNA being used to take him off the streets?
- DNA has let the genie
out of the bottle as regards secret adoptions and fosterings.
- If you want to keep family secrets secret, then keep your
own DNA
and the DNA of all of your relatives out of the online databases.
Submitting DNA Samples
The entry-level Y-DNA product is now Y-DNA37, which
looks at the numbers of repeats for
each of 37 STR markers on the Y
chromosome, e.g. the Clare Roots Project.
FTDNA customers may want to turn off usually irrelevant Y-12 and Y-25
match
notification e-mails on the Notification Preferences page.
In return for your DNA sample, you will get:
- a match list; and
- a predicted haplogroup
or terminal SNP.
The word haplogroup
has long
been used to describe any group of men with similar Y-DNA (or a group
of people with similar mtDNA):
- originally, a haplogroup referred to a group of men with
similar patterns of STR values;
- as the science of analysing the Y chromosome has evolved, a
haplogroup has come to refer to a group of men with the same SNP
mutation.
SNPs can be used to build a Y-DNA Haplogroup Tree or haplotree, with more
recent SNPs shown as children of older SNPs.
There has been a SNP Tsunami in recent years: from about 800 SNPs in
2012 to more than 35,000 SNPs by 2015.
Some branches of the haplotree:
The Y chromosome is only 59,373,566 letters long, so there is an upper
bound to the number of SNPs that may eventually be discovered.
Men with the same
SNP mutation tend to also have similar patterns of STR mutations, so
STR mutations are used to predict SNP mutations.
FTDNA now
uses "haplogroup" (on the Y-DNA Colorized Chart)
interchangeably with "Terminal SNP" (on the Y-DNA - Matches page).
- FTDNA's automated SNP predictor plays safe and confidently
predicts only high-level (ancient) SNPs, e.g. R-M269
- Project administrators can usually, if less confidently,
predict more recent SNP mutations and can group members into
predicted haplogroups with their closest relatives on the project results page.
STRs can only predict
Y haplogroups but a SNP product must then be purchased to confirm the
Y haplogroup:
- single SNP
- SNP pack
- Big Y500
Known relatives should pool their funds to purchase more advanced
testing or donate to relevant projects,
rather than
waste money merely confirming known relationships.
Donations to FTDNA projects must be used to purchase FTDNA products for
members and can not be used for any other purpose.
Overlaying SNPs and Surnames
Sometimes the Irish annals tell us that certain groups of surnames can
be expected to have similar Y-DNA signatures.
Sometimes Y-DNA results tell us that certain groups of surnames are
closely related.
Sometimes Y-DNA results tell us that common surnames have multiple
independent origins.
Example 1: The Dalcassian surnames
- O'Hart wrote:
91. Cas: the elder son; a quo the Dal
Cais or "Dalcassians;" b. 347. Had twelve sons:—1. Blad, 2.
Caisin, 3. Lughaidh, 4. Seana, 5. Aengus Cinathrach, 6. Carthann Fionn,
7. Cainioch, 8. Aengus Cinaithin, 9. Aodh, 10. Nae, 11. Loisgeann, and
12. Dealbheath.
- Families descended from Cas
include MacArthur, O'Beollan (or "Boland"), O'Brien, O’Brennan,
O'Casey, MacConsidine, O'Cormacan, Cosgrave, MacCraith, (or MacGrath),
O'Curry, Eustace, Glinn, Glynn, Hearne, O'Hogan, O'Hurley, O'Kelleher,
O'Kennedy, Magan, Maglin, MacMahon, O'Meara, Muldowney (now "Downey"),
O'Noonan, Power, Quirk, O'Regan, Scanlan, O'Seasnain, and Twomey.
- Genetic similarities have been
found in the last decade between men with these related
Dalcassian surnames.
- They generally have Irish
Type III DNA characterised
by the L226 SNP in Haplogroup R.
- yfull.com
reports that L226 was formed 4300 ybp, TMRCA 1400 ybp
- There is a project set up at Family Tree DNA for the R-L226 Haplogroup.
- 18.2% (70/385) of the men with Y-DNA results in
the Clare Roots project are confirmed or predicted L226+.
- Surname-specific SNPs are now
being discovered for the main Dalcassian surnames and will eventually
be discovered for all common
surnames.
Example 2: The Corcomroe (Corca Modhruadh) surnames
- Within the Clare Roots project, many common
County Clare surnames are found to share the L1336 SNP mutation:
Surname |
Clare
1911 |
Ireland
1911 |
Clare
% |
McGuane |
274 |
282 |
97.2% |
Marrinan |
266 |
281 |
94.7% |
Marinan |
54 |
59 |
91.5% |
Cahir |
111 |
134 |
82.8% |
Considine |
727 |
896 |
81.1% |
Davoren |
121 |
185 |
65.4% |
O'Loughlin |
617 |
1257 |
49.1% |
McNamara |
2194 |
6645 |
33.0% |
Donnellan |
324 |
996 |
32.5% |
Hanrahan |
442 |
1836 |
24.1% |
Neilon |
6 |
30 |
20.0% |
Clancy |
647 |
3650 |
17.7% |
O'Brien |
1666 |
24537 |
6.8% |
O'Neill |
623 |
18431 |
3.4% |
O'Donnell |
452 |
13510 |
3.3% |
Cunningham |
256 |
8965 |
2.9% |
O'Laughlin |
1 |
60 |
1.7% |
Carroll |
215 |
13815 |
1.6% |
O'Carroll |
4 |
569 |
0.7% |
Dunn |
1 |
1478 |
0.1% |
Marnen |
0 |
0 |
#DIV/0! |
|
|
|
|
- 7.5% (29/385) of the men with Y-DNA results in
the Clare Roots project are confirmed or predicted L226+.
- The O'Loughlins were one of the two most powerful families
of Corcomroe: see pedigree.
- According to Cairney, "The chief families of
the Corca Modhruadh were the O’Connors, MacCurtins, O’Loghlens,
O’Davorens and the Corca Thine."
- Davoren and O'Loughlin are prominent surnames in this Y-DNA
grouping, so it probably includes the descendants of the Corca
Modhruadh.
- L1336 has also been referred to as the "Clans of North
Clare" SNP.
- yfull.com has no estimate of the age of L1336.
- Several of these surnames appear in both the L226 and L1336
groups
Example 3: Specific surname projects
The more common a surname, the more independent genetic origins it appears to have:
- Within the Carroll Y-Chromosome DNA Surname Project (13,815 in 1911),
there are many independent genetic origins of the surname, including:
- Ó Cearbhaill of Loch Lein R-CTS4466
- Ó Cearbhaill of Tara R-M222
- Ó Cearbhaill of Eile R-Z16284 (see Ely Carroll block and FTDNA project)
- Ó Cearbhaill of Oriel R-Z3000
- Ó Cearbhaill of Ossory R-A641
- Carrell.Carroll of Kilkenny/Tipperary R-FGC33220
- (O')Carroll of North Kerry R-A933
- O'Carroll of Clare ?-???
- etc., etc.
- Within the Clancy Surname (DNA) Project (3,650 in 1911), there are eight independent genetic origins.
- Within the O'Dea/O'Day/Dee (DNA) Project (1,318 in 1911), there are about 16 independent genetic origins, but some may be Days with no Irish connection.
- There are very few instances of perfect correlation between
surnames and Y-DNA, except perhaps the Marrinans (281 in 1911).
The Future
- Recruit more men
- Upgrade more men to Big Y-500 (Big Y + Y111)
- Confirm terminal SNPs for existing project participants
- Use SAPP to generate mutation
history trees
- Develop a statistical methodology to predict SNPs more
precisely from STRs, more cheaply than Big Y500
- Further reading on Y-DNA