Genetic Genealogy for Beginners

SO02 Introduction to Irish Family History

6 p.m. Monday 8 February 2021

WWW version:

http://pwaldron.info/TCD/beginners/2021

YouTube version:

TBA

Outline

Context
Definitions

Components of DNA
Inheritance paths
Mutations
Recombination

Using the DNA websites
A case study

Context

Your sources

This session will teach you methods to get the most out of your DNA as a source.
The objectives are to learn how to

interrogate and extract relevant evidence from your DNA, as you would with any other source; and
to find hints and leads from the online DNA databases to other surviving sources.

You are the expert on your own family history as you have:

the family's oral traditions in your memory;
the family papers in your attic, or wherever they are kept; and
the family DNA in every cell of your body.

The genealogist's task is to compile family histories by reconciling these three categories of private information

with each other; and
with public information.

Genealogical records have been created by the actions of our ancestors and of ourselves:

We are the first generation to create digital records of our DNA.
The value of DNA comparison to genealogists increases dramatically with the number of people from the relevant geographical area and relevant extended family group already in the DNA databases used.
See chart and report on database sizes (which does not stress the U.S. bias in most of the databases).
We still need to persuade more known and possible Irish relatives to submit DNA samples to the databases for purely genealogical purposes.
Your descendants will be eternally grateful to you for leaving them your DNA.
Do unto them as you wish your ancestors had done unto you.

Your own DNA (and especially the DNA of any living parents or grandparents) is one of your most important genealogical sources.
Deciding not to use your DNA is now the equivalent of deciding not to use census returns.

Your conclusions

The genealogist must organise all the relevant evidence from the sources (oral and paper-based, private and public, traditional and DNA) in an easily searchable lineage-linked computer database format, e.g.

Ancestral Quest, which I use
RootsMagic
Reunion
Family Tree Builder
any of the numerous other programs listed on Wikipedia
even in the "cloud" (if you have superfast broadband and believe that clouds never evaporate, or have a good backup policy).

Good genealogy software allows you to save selected information from your database using an internationally recognised standard file format known as GEDCOM
Some or all of the database can be uploaded from time to time to a website if desired
The part detailing your direct ancestors must be uploaded in conjunction with your DNA data.
The traditional linear family history narrative that might be published in book format can be:

generated automatically from the database;
contained in free-form notes fields within the database; or
produced as a separate stand-alone end product, using the database as a guide.

Caveats

DNA has let the genie out of the bottle as regards secret adoptions and fosterings.
DNA comparison is being used to identify birth parents and their children who were given up for adoption.
Those involved in adoptions have sometimes conflicting rights to information and rights to privacy.
If you want family secrets to remain family secrets, then you need to keep your immediate family members out of DNA comparison databases - including the future children and grandchildren of any unborn children that you desert (see case study below).
Treat family secrets and those directly involved as sensitively and sympathetically as possible.
Professional help is available.
Insurance companies would like to use:

knowledge of your good genes to make your health insurance cheaper and your pension more expensive; and
knowledge of your bad genes to make your health insurance more expensive and your pension cheaper.

Law enforcement authorities would like to use the same techniques as are used to solve adoption cases in order to identify DNA from serious crime scenes and from unidentified remains.
Collaborating with law enforcement in some jurisdictions may result in a distant relative being subjected to the death penalty.
Anonymising your DNA will impede your genealogical discoveries.

Communities

DNA comparison will

match you with the most closely related individuals already in the DNA database;
estimate a range of possible relationships to those on your match lists;
but leave you to establish your precise relationship using supplementary evidence from traditional sources.

Your DNA will link you to genetic communities:

You will find groups of DNA matches whose most recent common ancestor (MRCA) with you may be just over the present brick walls in your family tree.
Research has established that people whose ancestors lived close to each other geographically are now themselves close to each other genetically.
The converse is not necessarily true: people from Place A may share DNA with people from Place B, but their most recent common ancestors may have lived in Place C.
The correlation between genes and geography allows the DNA companies to peddle estimated ethnicity percentages, almost inevitably presented without any mention of the associated margin of error.
The DNA companies are still looking for GAA people (people with Geographically Anchored Ancestry) to form reference populations and provide improved ethnicity estimates.

Your DNA will also make you part of new research communities:

FamilyTreeDNA.com hosts three types of DNA projects, co-administered by people like me:

geographically-based, e.g.:

Clare Roots (co-administator Terry Fitzgerald, WA, USA; 1568 members as of 8 February 2021)
Kerry Y-DNA Project (administrator John Hallissey, Waterford; 137 members)

surname-based, e.g.:

Clancy (administrator Fergus Clancy, Dublin; 110 members)
Durkin/Durkan/Durcan (administrator Mike Durkin, NY, USA; 33 members)
Marrinan (administrators Cory Marinan, WI, USA; Cindy Wood, MI, USA; Greg Marrinan, CT, USA; 83 members)
McNamara (rescued from worldfamilies.net and GDPR; 129 members)
O'Dea/O'Day/Dee (administrator James O Dea, Dublin; 128 members)
McManus (148 members)

haplogroup-based, e.g.:

R-M222 and Subclades (Irish Type I) (2867 members)
R1b-CTS4466 Plus (Irish Type II) (1070 members)
R-L226: The Irish Type III cluster (801 members, including some of the Clancys, McNamaras and O'Deas)

Group General Fund Contributions can be used solely to pay for analysis by FTDNA of the DNA of new or existing members.
Surname projects at FTDNA complement traditional surname studies like those affiliated to

Definitions

According to Wikipedia, genetic genealogy is
the use of genealogical DNA tests, i.e. DNA profiling and DNA testing in combination with traditional genealogical methods, to infer biological relationships between individuals.
"Testing" does not mean just sending a DNA sample to a laboratory; it means using DNA to test a specific hypothesis derived from traditional genealogical methods.
The DNA companies are not "testing companies" or "testing laboratories" - they just provide the tools for the genealogist to test his or her own hypotheses.
The best hypothesis-testing website is WATO (see case study below).

Components of DNA

What is DNA?
- short for deoxyribonucleic acid
- made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
- represented by strings of the letters A, C, G and T
- DNA labs turn saliva or cheek swabs into data files of As, Cs, Gs and Ts:
```
RSID CHROMOSOME POSITION RESULT

rs4477212 1 72017 AA

rs3094315 1 742429 --

rs3131972 1 742584 GG

rs12562034 1 758311 --

rs12124819 1 766409 --

rs11240777 1 788822 AG

rs6681049 1 789870 --

rs4970383 1 828418 CC

rs4475691 1 836671 CC

rs7537756 1 844113 AA
```
- these data files can be copied to other DNA comparison websites
Where does our DNA come from?
- DNA is inherited by every child from its parents,
- When a sperm fertilises an egg, each brings DNA, which is replicated in every cell of the resulting person.

	male offspring	female offspring
sperm	Y chromosome	X chromosome
	paternal autosomal chromosomes 1-22
egg	X chromosome
	maternal autosomal chromosomes 1-22
	mitochondria

Inheritance paths

See pedigree chart.

Y chromosome: Only males have a Y chromosome.
Y-DNA comes down the patrilineal line - from father, father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.
X chromosome: Males have one X chromosome, females have two.
X-DNA may come through any ancestral line that does not contain two consecutive males.
Blaine Bettinger's colour-coded blank fan-style pedigree charts show the ancestors from whom men and women can potentially inherit X-DNA.
Autosomes: Short for autosomal chromosomes; Exactly 50% of autosomal DNA (atDNA) comes from the father and exactly 50% comes from the mother.
Due to recombination, on average 25% comes from each grandparent, on average 12.5% comes from each greatgrandparent, and so on.; In extreme cases, an individual can inherit up to 35% from one paternal grandparent and, hence, as little as 15% from the other paternal grandparent.
Siblings each inherit 50% of their parents' autosomal DNA, but not the same 50% (except for identical twins).
Similarly, siblings each inherit 50% of their mother's X-DNA, but not the same 50% (except for identical twins).
Sisters each inherit 100% of their father's X-DNA.
Mitochondria: Everyone has mitochondrial DNA (mtDNA).; Mitochondrial DNA comes down the matrilineal line - from mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.

The following table summarises these critical distinctions:

DNA component	Inheritance path	Inherited by
Y chromosome	From father only (and only if male)	males only
autosomal chromosomes	Equally from both parents	everyone
X chromosome(s)	Unequally from both parents	males x1, females x2
mitochondrial DNA	From mother only	everyone

Autosomal DNA is the cheapest component to analyse and has rapidly become the most widely used in genealogy.
Y-DNA has been widely used for one name studies or surname projects for much longer, but has also seen rapid recent scientific advances.
Targeted mitochondrial DNA and X-DNA comparisons can be used to solve more specialised problems (e.g. a tale of two X-chromosomes).

Mutations

Mutations are the first type of random variation in the inheritance process (of all four components of DNA), and are like transcription errors.

Some locations mutate very frequently (every couple of generations), and can be used to identify individuals beyond reasonable doubt, e.g. in criminal cases.
Some locations mutate less frequently (only once in many generations or once in the history of mankind), and can be used to identify closely or distantly related individuals.
Most locations never mutate and are the same for all humans (and for many other primates).

Special types of mutations:

Short Tandem Repeat (STR): a string of letters consisting of the same short substring repeated several times

for example, CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be repeated less or more often in other individuals.

Single Nucleotide Polymorphism (SNP): a single location where two (or occasionally more than two) different letters are observed in different individuals

for example, a single A in the parent may be replaced by a C in the child (and in all of the child's future descendants, until the next mutation at the same location.

Y-DNA Mutations

The Y chromosome is passed virtually unchanged from father to son.
Early Y-DNA analysis looked at the numbers of repeats for each of 12 STR markers on the Y chromosome.
Now Surname Projects look at 111 STRs.
The state-of-the-art Big Y-700 product reports values for 700+ STRs.
Genetic distance between two men is, roughly speaking, the number of differences between their STR signatures, e.g. 0/12 or 9/111.
The smaller the genetic distance between two men, the closer their expected relationship.
The correlation between genetic distance and degree of relationship is not perfect:

When an STR mutation occurs, the subject of the mutation is genetic distance 1/37 (say) from his father;
until the next STR mutation occurs, all descendants of the subject of the mutation are genetic distance 0/37 from their most recent common ancestor.

Some SNP mutations on the Y chromosome are once-in-the-history-of-mankind events and can be used to build a Y-DNA Haplotree, which has evolved from the original Simplified Tree of Y-Chromosome Haplogroups (top level haplogroups A-R are about 20,000 years old).
Surname-specific SNPs are now being discovered.

Autosomal DNA Mutations

The DNA companies observe only 0.02% or so of the locations on the autosomes.
These are the locations known to have SNP mutations.

Recombination

Recombination is the second type of random variation in the inheritance process (of autosomal DNA and maternal X-DNA only) and is how, e.g., the father's paternal and maternal autosomes cross over to produce the child's paternal autosomes.

Every sperm and egg is potentially unique.
Recombination of the paternal and maternal chromosomes is sometimes compared to shuffling two decks of playing cards.
Recombination rates vary markedly along the autosomes and the X chromosome.
The local recombination rate is referred to as genetic length and is measured in units called centiMorgans, which estimate the number of generations to the common ancestor of two individuals sharing an identical long run of letters.
One recombination per generation is expected in each 100 centiMorgans (cM, not cm).
The greater the genetic length of the DNA shared by two individuals, the closer the expected relationship.
The correlation between shared centiMorgans and degree of relationship is not perfect.
Shared cM varies from around 3600cM for identical twin and parent/child relationships to around 8cM for very distant cousins to 0cM for unrelated individuals.
See Shared cM Project chart and tool and TheDNAgeek chart

Using the autosomal DNA websites

It you want to identify your long-lost cousins, to help them to find you, and to identify your and their long-forgotten ancestors, then you must link your DNA data and your known ancestry in the form of a pedigree chart and share them on all the major autosomal DNA comparison websites ("fish in all the gene pools").

To add your information to the online DNA databases:

Export a DNA data file from the DNA websites for which you have spat or swabbed and upload it to all the DNA websites that accept uploads.
Export a GEDCOM file containing at least the ancestors of each DNA subject and upload it to all the DNA websites so that matches can see a pedigree chart.
Examples of pedigree charts: from Ancestral Quest, AncestryDNA, ancestry.com, old FamilyTreeDNA, new FamilyTreeDNA and GEDmatch.
For FamilyTreeDNA.com, include in the GEDCOM file any paternal or maternal relatives already matching you at FTDNA with a longest block of 9cM or more and the shared ancestors; FTDNA will use these linked relationships to assign other matches to the DNA subject's paternal and maternal sides (example).

GEDmatch.com tools

User Registration
Generic Uploads (23andme, FTDNA, AncestryDNA, most others) (DNA data)
Upload GEDCOM (Fast)
One-To-Many DNA Comparison Result
One-to-One Autosomal DNA Comparison
People who match both, or 1 of 2 kits
Are your parents related? (e.g. T409076)
Multi Kit Analysis
Autosomal DNA comparison matrix (see case study below).
Ancestor Projects (Surname, Geographical, Historical Roots)

These include X-DNA matches.

Tier 1 Utilities

Combine multiple kits into 1 superkit
Segment Search
Lazarus
etc.

etc.

FamilyTreeDNA.com tools

Dashboard

Matches
Chromosome Browser
Download Raw Data Build 37 Concatenated Raw Data (bottom right)

AncestryDNA tools

Test Settings

General Information: Tree Link
Test Management: Actions: Download Raw DNA Data
Privacy: Sharing Preferences: Change (+ Add a person)

Match list

Search Matches (by Match name, Surname in matches' trees or Birth location in matches' trees, if available on the dropdown)
search results appear incomplete for new kits

Match page

Shared Matches

MyHeritage Tools

The best shared match list of all the websites, identifying triangulated matches.
If you have duplicate kits at FTDNA (e.g. swab kit + uploaded kit), then

one kit can be used with the normal pedigree chart and multiple linked relationships;
the redundant kit can be used with a single linked relationship to filter triangulated matches from the in-common-with (ICW) list (details here).

Some basic common principles:

The basic rules for successful use of the DNA websites include the following:

Reveal the DNA subject's birth surname:: Most people inherit DNA with their birth surname, so identify yourself as a minimum by your birth surname with an initial or a title, e.g., P Waldron or Mr Waldron or Miss Durkan.
Reveal the gender of the person who provided the DNA sample:: Valuable additional inferences can potentially be drawn once it is known whether two X chromosomes (female) or one X chromosome and one Y chromosome (male) are potentially available for comparison.
Women do not have Y-DNA and are encouraged to recruit their male relatives to provide Y-DNA, but they must NOT attach a female name to a male DNA sample, as this causes untold confusion.
Be especially careful not to inadvertently link a male's Y-DNA results with a female's autosomal DNA results at FamilyTreeDNA.com where error-checking does not look for this.
Also take care not to link a male DNA sample to a female's pedigree chart (or vice versa).
Avoid providing irrelevant information:: Your first name, married surname, adopted surname or marital status reveal nothing about your DNA, so you may keep these private if you wish.
Avoid pseudonyms:: They reduce the chances that your matches will bother to look at your family tree, contact you or share the information about your ancestry that they have and that you do not have.
Keep all your DNA-related correspondence in a single searchable e-mail archive: Use the internal messaging system and AncestryDNA/MyHeritage/23andMe/LivingDNA or Facebook messages only to exchange e-mail addresses.

A case study: the Lynches of Moveen West

Episode 1

Background:

Pádraig Máire Neans (b. Abt 1826/9, d. 1907) and Tomás Máire Neans (b. Abt 1838/41, d. 1921) are remembered in the oral tradition as two Lynch brothers living across the road from each other in Moveen West.
They survived the Great Famine in Moveen.
Their mother Máire is remembered as one of two sisters between whom an O'Dea farm was divided - Mrs Lynch and Mrs O'Connell (later evicted?).
In Griffith's Valuation in 1855, Mary Lynch (apparently widowed) and her son Patrick Lynch (recently married) are listed as occupiers.
A third Lynch brother, Daniel, went to Connecticut, where his death certificate confirms his parents' full names:
Daniel Lynch, Newtown, Aug 4, 62, male, married, County Clare, Ireland, Newtown Conn, Paralysis Caused by fall, Farmer, W, Michael Lynch, Mary O'Day, Albert L Schuyler MD
[3rd last line on each page]
Daniel is buried in St. Rose's Cemetery in Sandy Hook.

20 June 2016: Donation from the diaspora to Clare Roots project "to go towards the test cost for a descendant of the Moveen West Lynch families".
Around the same time, the Lynch siblings of Sacramento began to show up as autosomal DNA matches to "all the usual suspects" - people with roots on the Loop Head peninsula in West Clare.
What they then knew about their Irish-born grandfather:
Because our grandfather, Eugene Lynch, is such a mystery to us we really don't know how to find him. All we have for certain is the 1910 census [lines 39-43]. It says he came over in 1887. The story is this: Eugene married my grandmother in San Jose in 1904 and they lived in Sacramento. He abandoned her and their children in 1909 [sic] when my grandmother was pregnant with my father. We didn't really know anything about him until we started doing this genealogy. We knew [sic] he died in San Francisco in 1917 but were surprised to discover that he was the captain of a schooner at the time.

6 October 2016: I uploaded the new recruit to GEDmatch.com and found this triangulation:

8 8,292,285 54,555,905 50.2 10692 Claire/Ed
8 17,609,398 38,378,638 27.4 5563 Ed/Michael
8 17,648,866 37,812,773 26.9 5499 Michael/Claire

Claire and Ed are fourth cousins, descended from Mrs Lynch and Mrs O'Connell respectively.
So their 50.2 centiMorgan half-identical region must contain an O'Dea segment.
Michael is Eugene Lynch's grandson, so Michael must be related to Mr O'Dea (first name still unknown) or Mrs O'Dea (Neans) or descend from both.
Eugene's surname is Lynch, so he must descend from Michael Lynch and Mary O'Dea.
Eugene (41 in 1910) is too young to be Michael and Mary's son (their known children have implied birth years 1824-1841).
Eugene's baptism is not in the parish registers, which survive from 1852.
Eugene's descendants share too much DNA with other descendants of Michael Lynch and Mary O'Dea for him to be their greatgrandson.
So he must be their grandson.
Even this implies a somewhat implausibly large 209.5cM shared between 3C1R - see Autosomal Matrix Comparison and Table of Probabilities.
15 November 2016: The Sacramento Lynches arrive in Moveen:
That day was the highlight of our trip to Ireland, and for me it was an unbelievable gift. I have been wondering and imagining for so long about my grandfather's (and thus my own) origins that I still quite can't believe I went there. It was a profound and moving experience for me. My sister Pat and I speak of it often ... It was magical to us. Both of my parents were from families who didn't stay connected with their homeland, and this journey has really fulfilled a need that I hadn't realized I had. I'll be forever grateful to Tom Kearney for introducing me to you, and to you for so generously sharing your expertise with us.
For over two years, we swabbed various descendants of the known sons of Michael Lynch and Mary O'Dea in search of closer matches and of further clues, but failed to identify Eugene Lynch's father.

Episode 2

8 March 2019: The Sacramento Lynches return to Moveen (Facebook post).
An epiphany on the road to Kilkee - a new hypothesis to be tested: Could Eugene have taken his mother's surname?
No sign of a Eugene Lynch born to a single mother in the local workhouse.
We have analysed autosomal DNA matches extensively, but did we ever check Michael Lynch's Y-DNA matches?

The Y-DNA and the surname both follow the male line, unless there is a surname/DNA switch.
Not a Lynch to be seen in Michael's matches
Two Currys out of nine Y-DNA111 matches.
Four more Coreys or Currys (including an adoptee), none of whom has bought Y-DNA111, in his top 12 Y-DNA67 matches.

Surname spellings also mutate, independently of DNA mutations.
Corey, Corry, Curry, O'Curry, Ó Comhraí should all have the same Y-DNA signature; likewise Lynch, Lindsey, Lynskey, Lynchahaun, Lynchaghaun, etc.
Could Eugene Lynch really be another Eugene O'Curry?
Not the parent expected? (NPE)
The DNA evidence often fills gaps in the traditional evidence, but sometimes refutes it.
His famous namesake reputedly descends from the O'Currys of Lisluinaghan (see repeatedly evaporated Rootsweb post).
The Mary Lynch who married Thomas Corry/Curry of Lisluinaghan appears to have been a daughter of Michael Lynch and Mary O'Dea:

98.5 centiMorgans shared between a descendant of Daniel Lynch and a descendant of Mary Curry, who could be no closer than 3C1R;
Pat Corry from Lisluinaghan witnessed the shotgun wedding of Michael Lynch of Moveen in 1882 - were they first cousins? Or even double first cousins?

Thomas Curry and Mary Lynch had a youngest son called Eugene, baptised in Kilkee parish on 10 Apr 1866:

"this ancestor has been very elusive";
he had "previous";
no sign of Eugene Curry in 1900;
his wife Ellen Curry née Kelly was a live-in servant in Brooklyn (line 48);
Ellen's sister Mrs Margaret Blomberg was taking care of Eugene and Ellen's daughter Margaret in Brooklyn also (line 93);
Eugene's brother Simon Corey was taking care of Eugene and Ellen's daughter Elsie in Newtown, CT (line 96);
the family lore passed down has always been that "Eugene Curry “went west” to find his fame and fortune and would send for his family at a later date. He was never heard from again."

209.5cM shared between 2C1R makes a lot more sense than 209.5cM shared between 3C1R.
"The idea of the two Eugenes being one is a bit staggering and mind-boggling" for his descendants, and even for me.
Further investigation of the DNA matches shared by known Lynch and Corry descendants in different DNA databases has left little doubt that Eugene Curry became Eugene Lynch.