Analysing and Understanding Y-DNA Results and Y-DNA Projects
2:45 p.m. Saturday 13 April 2019
WWW version:
YouTube version:
Outline
Clans,
surnames, last names and DNA
- According to Aistear, there are subtle
differences between the meanings of the Irish words clann, teaghlach and muintir.
- According to Clans of Ireland:
Irish clans were composed of those who were
related by blood but also by those who were adopted and
fostered into
the clan as well as those who joined the clan for strategic
reasons
such as safety or combining of lands and resources. However,
all
members of the clan bore the same surname.
- and also:
membership of an Irish Clan is based on one's
inherited and chosen identity and not on bloodline descent
alone.
- Statistically, we are almost certainly all descended from Brian Boru (d.1014)
(and from every other Irish person of his generation who has
living
descendants today). Why?
- 10 generations ago, around 1700AD, we all had 1,024
GGGGGGGGgrandparents
- Were they unique?
- 20 generations ago, around 1400AD, we all have over a
million slots to fill on our pedigree charts.
- 30 generations ago, around Brian Boru's time, we all have
over a billion slots to fill on our pedigree charts.
- I estimate that there is about a 95% chance that any pair
of individuals in the audience are 12th cousins or closer.
- For more on these topics, see here.
- Why do we feel a closer connection to people who share our
surname?
- DNA is:
- made up of chromosomes and mitochondria, each consisting
of
molecules of four nucleotides
named adenine (A), cytosine (C), guanine (G) and
thymine
(T)
- represented by strings of the letters A, C, G and T
- 59,373,566 letters on the Y chromosome alone
- When a sperm fertilises an egg, each brings DNA, which is
replicated in every cell of the resulting person.
|
male
offspring |
female
offspring |
| sperm |
Y chromosome |
X chromosome |
| 22 paternal autosomes |
| egg |
X chromosome |
| 22 maternal autosomes |
| mitochondria |
- Autosome
is short for autosomal chromosome.
- Each component has its own inheritance path:
- Y chromosome (the subject of today's talk)
- Only males have a Y chromosome.
The Y chromosome comes down the patrilineal line - from
father,
father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames.
Brian Boru's Y chromosome survives virtually unchanged in
his male line
O'Brien descendants today.
- X chromosome
- Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not
contain two
consecutive males.
- Autosomes (heavily marketed by AncestryDNA etc.)
- Exactly 50% of autosomal DNA comes from the father and
exactly 50% comes from the mother.
On
average 25% comes from each
grandparent, on average
12.5% comes from each greatgrandparent, and so
on.
- Very little of Brian Boru's autosomal DNA has survived
this recombination
process intact in his countless living descendants today.
- Mitochondria
- Everyone has mitochondrial DNA.
- Mitochondrial DNA comes down the matrilineal line -
from
mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this
line.
Do you know who would share your surname if surnames were
inherited
matrilineally instead of patrilineally?
- Our greater affinity with those who share our surname than
with those who share our mitochondria is a strange mixture of a
genetic
connection (the Y-chromosome) and a linguistic connection (the
surname).
- Pairs of third cousins may occasionally not share any
autosomal DNA.
- Pairs of thirtieth cousins in the direct male line always
share Y-DNA, and
often share a surname.
- Men with an interest in their surname history should not
only join the relevant surname or clan group, but should also
submit a
DNA sample for Y-chromosome analysis.
- A woman does not have a Y chromosome, so should find a male
relative with the relevant surname to swab:
- a father, brother, nephew, cousin, etc., if her interest is
in her maiden surname;
or
- a husband, son, brother-in-law, father-in-law, etc., if her
interest is in her married
surname.
SNPs,
STRs and DNA signatures
- The Y-chromosome, like the surname, is passed virtually
unchanged from father to son, with just occasional mutations or
mistranscriptions.
- Over tens of thousands of years, these occasional mutations
add up to give a wide distribution of different Y-DNA signatures
today.
- Two types of mutation can be found on the Y chromosome,
both known by
TLAs starting with S:
- A single-nucleotide polymorphism,
abbreviated SNP and pronounced snip,
is a single location where there is a
relatively high degree of variation between different people.
- For example, most people may have an A at one such
location, with a minority having a C.
- A short tandem repeat (STR) is a
string
of
letters consisting of the
same short substring repeated several times, for example
CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times.
- The number of repeats may occasionally increase or
decrease
between
parent and child, due to mutations.
- Many SNPs are once-in-the-history-of-mankind mutations.
- Over 160,000 of these have now
been
identified on the Y chromosome, with these important properties:
- These mutations have occurred exactly once.
- Every man
descended from the man in whom the mutation originally
occurred
inherits the mutation.
- No other man has the mutation.
- These SNP mutations are used to assign men to progressively
smaller and more recent "haplogroups" and to place them on the
human
family tree or Tree of
Mankind,
often called the Y
haplotree, with the ultimate objective of identifying
surname-specific SNP mutations:
- Who was Y "Adam"?
- The "biblical Adam" was the first and only male in the
world at the time of creation.
- The "genetic Adam" or "Y-Adam", the most recent common
patrilineal ancestor of all men alive today, was merely the
only male
in the world in his day whose
male
line descendants have not yet died
out.
- Y-Adam is estimated to have lived between
160,000 and 300,000 years ago.
- Surnames can be overlaid on the Tree of Mankind:
- The
Big Tree
- Niall of the Nine Hostages branch (R-M222 SNP)
- Dalcassian branch (R-L226 SNP)
- All R-DCxxxx SNPs are descendants of R-L226.
- Results can be copied
(free of charge) from FamilyTreeDNA.com to The Big Tree.
- FamilyTreeDNA.com has recently introduced its own version
of The Big Tree, called the Big-Y Block Tree.
- Or SNPs can be overlaid on surname trees from the annals:
- O'Hart wrote:
91. Cas: the elder son; a quo the Dal
Cais or "Dalcassians;" b. 347. Had twelve sons:—1.
Blad, 2.
Caisin, 3. Lughaidh, 4. Seana, 5. Aengus Cinathrach, 6.
Carthann Fionn,
7. Cainioch, 8. Aengus Cinaithin, 9. Aodh, 10. Nae, 11.
Loisgeann, and
12. Dealbheath.
- Families descended from Cas
include MacArthur, O'Beollan (or "Boland"), O'Brien,
O’Brennan,
O'Casey, MacConsidine, O'Cormacan, Cosgrave, MacCraith, (or
MacGrath),
O'Curry, Eustace, Glinn, Glynn, Hearne, O'Hogan, O'Hurley,
O'Kelleher,
O'Kennedy, Magan, Maglin, MacMahon, O'Meara, Muldowney (now
"Downey"),
O'Noonan, Power, Quirk, O'Regan, Scanlan, O'Seasnain, and
Twomey.
- Another version
- Examples of surname-specific or almost surname-specific
SNPs:
- All Marrinans are R-BY19489+
and vice versa (Big Tree branch; FTDNA Marrinan project).
- Many O'Briens are R-DC782+, but so are one group of
O'Days/O'Deas (Big Tree branch; FTDNA O'Dea project)
- O'Dea and O'Brien clans fostered each other's children
in mediaeval times.
- Was there a surname/DNA switch?
- Did an O'Brien child fostered by the O'Dea clan take
the O'Dea surname?
- The original O'Deas appear to be R-DC135+, as is a
Fitzgerald:
- "Thomas Fitz Garrolde [Fitzgerald], alias Adaye
[O'Dea], Grutchins, Co. Kilkenny, gent." received a pardon
in 1566.
- Jim Walsh in Sliabh
Rua: A History of its People and
Places (p. 73) raises the question:
Did Thomas O'Dea of Gorteens adopt his wife's
surname [Fitzgerald] on occasion out of political
expediency in his
dealings with
the Tudor government, or did he have a Geraldine pedigree
after all,
which was revised by such a marriage?
- Thomas's descendants certainly used the Fitzgerald
surname.
- DNA answers Walsh's question about the true genetic
surname: there was a surname/DNA switch in the 1500s.
- A man's place (or a surname's place or a clan's place) in
the human
family tree, or his DNA
signature, is now generally described by the most recent confirmed SNP,
misleadingly described as the terminal
SNP.
- "Terminal" has an implication of finality and permanence,
but a man's
most recent confirmed SNP can actually change frequently for two
reasons:
- he may purchase additional SNP
tests (single
SNPs, SNP packs or Big Y-700 at USD649) for SNPs which are
descendants of his
current
most recent confirmed SNP; and/or
- additional more recent once-in-the-history-of-mankind
SNPs (for which
he is positive) may subsequently be discovered.
- SNPs and STRs can be combined into mutation
history trees.
Relationships
between
surname groups and within surname groups
- SNP comparisons make it very easy to find relationships
between surname groups.
- SNP differences trump STR results regarding how closely two
men
are related to one another.
- STR comparisons remain useful for estimating relationships
between men with the same surname and/or with the same terminal
SNP.
- So an STR product is still the entry-level purchase for most
men.
- Y-DNA37 can be ordered at a discounted
price (currently USD149) through a FamilyTreeDNA project, for
example (if you have ancestors who lived
in County Clare, Ireland) the Clare Roots project which I
administer.
- Patterns of STR values were the
original DNA signatures of
surnames and clans, but have been replaced by the more
definitive SNP
signatures.
- SNP comparisons can prove or disprove relationships beyond
a reasonable doubt.
- STR comparisons can prove or disprove relationships on the
balance of probabilities.
- Patterns of STR values can still be used to predict SNPs.
- Comparisons of patterns of STR values is still the main
method used by FamilyTreeDNA.com
to identify Y-DNA matches.
- In principle, your match list should contain dozens of men
with your
exact surname.
- In practice, there are many reasons why this may not be the
case:
- your surname (or your male line beyond the adoption of
your
surname) may not be one of those which have
proliferated due to many men of the surname (or male line)
each having
several sons;
- your surname (or male line) may be in danger of being
"daughtered out",
due to
many men of the surname (or male line) not marrying or
fathering only
daughters;
- there may be no other man of your surname in the FTDNA
database (e.g. no Geheran in April 2019);
- there may be only a few people of your surname in the
FTDNA
database (e.g. there were only 16
Dungans of either gender in April 2019);
- there may have been no concerted effort to recruit men of
your surname to the FTDNA database;
- there may have been a concerted effort to recruit men of
some genetically related surname to the FTDNA database;
- the men of your surname in the FTDNA database may not yet
have ordered any Y-STR product;
- there may have been an above average number of STR
mutations in
your male line in recent generations, resulting in few matches
of any
surname;
- there may have been a below average number of STR
mutations
in
your male line since the adoption of surnames, resulting in
many
matches with men whose common ancestry predates the use of
surnames;
- there may have been an overt or covert surname/DNA switch
in your male line since the adoption of surnames;
- your surname may have multiple independent genetic
origins;
- your male line relatives may have translated the surname
back and forth
between languages in different ways (see Sir Robert Edwin
Matheson's Varieties
and synonymes of surnames and Christian names in Ireland:
for the
guidance of registration officers and the public in
searching the
indexes of births, deaths, and marriages);
- your male line relatives may have settled on different
standardised spellings of the surname once the computer age
put an end
to spelling diversity; and/or
- your close relatives may have reverted to an ancient
spelling of your surname discovered in their research.
- My Y-DNA111
matches as of 11 February 2019.
- My top
Y-DNA67 matches as of 11 February 2019.
- DNA provides only crude estimates of the number of
generations to the most recent common ancestor of two men.
- The TiP
calculator estimates the number of generations to the
most
recent common male line ancestor of two STR matches.
- The equivalent rule-of-thumb for the SNP block trees is
roughly
one mutation per century.
- The Marrinan project is an example of
a single-origin surname with a single terminal SNP and a very
stable
STR signature:
- 12 men:
- 6 with only 37 STRs
- 6 with 111 STRs
- 5 with terminal SNPs, all R-BY19489+
- 5 spelling variants.
- 11? different most distant known ancestors.
- All 12 match on 33 of the first 37 STRs.
- All 6 match on 73 of the last 74 STRs.
- There is one known Marrinan man who took his surname from
his
mother but is not yet in the project.
- The Carroll project is an example of a
multiple-origin surname with a wide variety of SNP and STR
signatures.
Setting
up and administering Y-DNA projects
- Y-DNA projects can be
- Once you have your initial Y-DNA
results (or a known male-line relative's Y-DNA results), you can
join
appropriate haplogroup projects.
- Some older project member and project administrator
features have been
disabled because of numerous changes prompted by GDPR fears:
- You must Opt in to Sharing on the PROJECT PREFERENCES page or your
pseudonymized DNA results and ancestor information will be
missing from
the public results pages.
- You can also choose from that page whether to give each
project
administrator Minimum, Limited or Advanced access to your kit;
reducing
access to Minimum pretty much eliminates all the benefits of
project
membership.
- It is also recommended that you set Y-DNA Match Levels to
All Levels on
the PRIVACY & SHARING page.
- If there is no existing project for your surname of
interest, then
start your own, but ...
- The first prerequisite (thanks to GDPR) is to have an
e-mail address
which you are prepared to expose to spammers and to other
non-FTDNA
customers; you may wish to establish a new e-mail address
specifically
for this purpose.
- Wikipedia defines a data
breach as "the intentional or unintentional release of
secure
or private/confidential information to an untrusted
environment".
- My long-standing guidelines
on e-mail etiquette
demand that my correspondents "please do not publish my e-mail
address
on any web page, news group, chat room, etc."
- If you are an ordinary customer of FTDNA, only your matches
can see
your e-mail address.
- If you are an FTDNA project administrator, everyone on the
internet,
whether an FTDNA customer or not, sees your e-mail address.
- This is part of the FTDNA Terms & Policies.
- If there is no surname project for your surname and you are
happy to
deal with the spam risk, then you can apply to
set up your own project by following a simple five-step application process (which
actually consists of only four steps!).
- Every project has an activity feed for discussions
between
members and administrators, which can be used by administrators
to
avoid having to answer the same frequently asked questions
repeatedly
via individual e-mails.
- Project administrators have valuable tools, including:
- a subgroup editor to arrange members
on the Y-DNA results
pages
- subgroups are sorted alphabetically on the results
pages, so bear this in mind when choosing names
- criteria for grouping can include:
- surname
- geography
- haplotree position, whether
- confirmed by FTDNA
- predicted by FTDNA
- predicted by project administrator
- desire to see STR differences highlighted
- Many of the colours available for distinguishing
subgroups don't work
very well, or at least my eyesight isn't good enough to use
them, as
the background colours are too close to the text colour.
- Subgroup Names (which are visible on the results pages)
appear to be
truncated at 161 characters, without warning. So keep these
names as
short as possible with no unnecessary spacing or
punctuation.
- Subgroup Descriptions (which are visible to the project
administrator(s) only) appear to be truncated at 973
characters,
without warning, and despite the false assurance of scroll
bars in the
editor.
- a Y-DNA genetic distance calculator:
- this has greater thresholds than the matching
algorithm:
7/37 instead of
4/37; 25/67 instead of 7/67 and 40/111 instead of 10/111
- examples: R-M222
for a man with one Y-DNA37
match with no SNP test; R-FGC29367
for a man with no
Y-DNA111 match.
- a public website editor to publish information under any
or all of the following headings:
- Background
- Goals
- News
- Updates
- Bulletin
- Results
- Code of Conduct
- FAQ
- Project members can be recruited in many ways:
- FTDNA will send an e-mail on behalf of an
administrator, no
more than once every six months, to all customers with the
relevant
surname who have opted to receive such e-mails.
- Administrators can see project members' matches and can
e-mail them directly to invite them to join.
- Your clan organisation is ideally positioned to run
online and offline recruitment drives.
Conclusion: Why you should submit your DNA
- The value of DNA "testing"
to genealogists increases dramatically with the number of
people with
the relevant surname
already in the DNA databases used.
- But your money is better spent on advanced
testing for one man than on duplicate testing for two known
close relatives.
- Submitting your Y-DNA to a
database has significant positive externalities for existing
and future
researchers, for example for
- your female relatives who
don't have a Y
chromosome; or
- for men with a surname/DNA
switch from your surname to another surname somewhere in
their lineage.
- We need to persuade more
Irish men to
submit
Y-DNA samples to the databases for purely genealogical
purposes.
- All of your
descendants will be
eternally
grateful to you for leaving them a sample of your autosomal
DNA.
- Your female
descendants will be
eternally
grateful to you for leaving them a sample of your Y-DNA.
- Only if you
have produced
male-line descendants are you absolved of your personal
responsibility
to preserve and record your own Y-DNA for posterity.
Further reading