Analysing and Understanding Y-DNA Results and Y-DNA Projects
3:00 p.m. GMT Friday 10 December 2021
WWW version:
YouTube version:
TBA
Outline
Family names, surnames,
last names and DNA
To begin, some linguistic niceties:
- Your speaker and your society are in different continents,
separated by a common language (a concept often
attributed to the Irish-born writer George Bernard Shaw).
- We all live in the surname era in which most (but not
all) people automatically inherit a family name at birth from
their biological (genetic) fathers.
- These names are variously described as heritable, hereditary
or inherited.
- These family names are generally inherited down the patrilineal
line over many generations - from father, father's father,
father's father's father, FFFF, FFFFF, etc.
- In the United States today, the inherited family name is
usually referred to as the last name.
- In some other cultures, the inherited family name is not the
last name, e.g.:
- In the United States today,
- everyone is expected to have a first name, middle
name and last name; and
- married women are often referred to by first name, maiden
surname and married surname in that order.
- In some other cultures, conventions differ:
- people may have an even number of names, e.g. Patrick
Waldron or Patrick Joseph Martin Waldron, so no middle name;
- migrants may adopt a middle name in order to conform;
- a patronymic in the old country (Patrick "Joseph"
meaning "Patrick son of Joseph") may become a middle name in
the new country (Patrick Joseph Waldron) rather than merely a
means of distinguishing two namesakes;
- in large families, the convention of naming sons after their
grandfather frequently resulted in sets of paternal first
cousins with the same name, requiring patronymics to
distinguish them;
- the maiden surname may be completely replaced by the married
surname;
- married women may be described as:
- Mary Jones Smith
- Mary (Jones) Smith (e.g WikiTree)
- Mary Smith (Jones) (e.g. geni.com)
- Mary Smith née Jones (where né [masculine] and née
[feminine] are the French for "born")
- Mary Jones (in baptismal registers, both as mother and
sometimes also when acting as a baptismal sponsor,
particularly alongside her husband, e.g. Marcella Blackall);
- beginners, particularly those not familiar with American
conventions, will find it very hard to remember which website
puts the maiden surname first and which website puts the
married surname first (just as they struggle to remember which
websites put the day first and which websites put the month
first in ambiguous all-numeric date formats).
- Many surnames evolved from patronymics or cumbersome strings
of patronymics, e.g.
- Johnson (son of John; English)
- FitzJames (son of James; Norman)
- Thomas FitzMaurice
FitzGerald (c. 1145-1213)
- Mac Mathúna/McMahon (son of Mahon; Irish)
- Mac Con Mara/McNamara (son of the hound of the sea; Irish),
sometimes abbreviated to plain Mack
- Ó Briain/O'Brien (grandson of Brian; Irish)
- O' and Mc prefixes became optional when Irish surnames were
converted to English, with two siblings sometimes known as,
e.g., Donovan and O'Donovan, even today
- Rasmussen (son of Rasmus; Danish)
- etc.
- The surname era began at different times in different
countries:
- about a thousand years ago in Ireland where it is claimed
that Ó Briain, derived from a High King of Ireland, Brian Boru
(d.1014), is the world's oldest surname;
- much more recently in Scandinavian naming
customs.
- There have been many discussions of the usage, evolution,
popularity and meaning of the terms surname, last name and
family name (e.g. here and here and here and this graph):
- my offline genealogy software (Ancestral Quest) uses Surname;
- my private online genealogy software (TNG) uses Last/Surname;
- my public online genealogy software (WikiTree) uses LNAB
(last name at birth) as a fundamental part of its structure;
- the Guild of One-Name Studies (GOONS)
just uses the word name in its own name, but promotes
Worldwide Surname Research on its home page;
- Finte na hÉireann ~
Clans of Ireland uses Clan, derived from clann,
one of three words in Irish representing subtly different
aspects of the English word family;
- FamilyTreeDNA.com asks customers for their Last Name
but then invites them to join Surname Projects;
- For the rest of this talk, I will use the word surname.
- Statistically, Irish people are almost certainly all descended from Brian Boru (and from
every other Irish person of his generation who has living
descendants today). Why?
- 10 generations ago, around 1700AD, we all had 1,024
GGGGGGGGgrandparents
- Were they unique?
- 20 generations ago, around 1400AD, we all have over a
million slots to fill on our pedigree charts.
- 30 generations ago, around Brian Boru's time, we all have
over a billion slots to fill on our pedigree charts.
- I estimate that there is about a 95% chance that any pair of
Irish people without recent immigrant ancestry are 12th
cousins or closer.
- The same applies to any area of similar population (6.6
million) before the era of easy intercontinental travel.
- For more on these topics, see this
academic blog.
- Why do we feel a closer connection to people who share our
surname?
- Some people use "we" to speak on behalf of generations of
long-dead ancestors of the same surname.
- Why are so many people more interested in their FFFF than in
their MMMM or in any of their other 14 GGgrandparents?
- Why do people spend more time studying the matrilineal ancestry of
thoroughbred racehorses than of their fellow humans?
- DNA is:
- made up of chromosomes and mitochondria, each consisting of
molecules of four nucleotides
named adenine (A), cytosine (C), guanine (G) and thymine (T)
- represented by strings of the letters A, C, G and T
- 59,373,566 letters on the Y chromosome alone
- When a sperm fertilises an egg, each brings DNA, which is
replicated in every cell of the resulting person.
|
male offspring |
female offspring |
| sperm |
Y chromosome |
X chromosome |
| 22 paternal autosomes |
| egg |
X chromosome |
| 22 maternal autosomes |
| mitochondria |
- Autosome is short for
autosomal chromosome.
- Each component has its own inheritance path:
- Y chromosome (the subject of today's talk)
- Only males have a Y chromosome.
The Y chromosome comes down the same patrilineal line
generally followed by surnames.
Brian Boru's Y chromosome survives virtually unchanged in
his male line O'Brien descendants today.
- X chromosome
- Males have one X chromosome, females have two.
X DNA may come through any ancestral line that does not
contain two consecutive males.
- Autosomes (heavily marketed by AncestryDNA etc.)
- Exactly 50% of autosomal DNA comes from the father and
exactly 50% comes from the mother.
On average 25%
comes from each grandparent, on average 12.5% comes from each
greatgrandparent, and so on.
- Very little of Brian Boru's autosomal DNA has survived
this recombination
process intact in his countless living descendants today.
- Mitochondria
- Everyone has mitochondrial DNA.
- Mitochondrial DNA comes down the matrilineal line - from
mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this
line.
Do you know who would share your surname if surnames were
inherited matrilineally instead of patrilineally?
Why is the thoroughbred racehorse industry preoccupied with
mitochondrial DNA?
- Our greater affinity with those who share our surname than
with those who share our mitochondria is a strange mixture of a
genetic connection (the Y-chromosome) and a linguistic
connection (the surname).
- Pairs of third cousins may occasionally not share any
autosomal DNA.
- Pairs of thirtieth cousins in the direct male line always
share Y-DNA, and often share a surname.
- Men (i.e. chromosomally male people) with an interest in their
surname history should not only join the relevant surname group,
but should also submit a DNA sample for Y-chromosome analysis.
- A woman (i.e. a chromosomally female person) does not have a Y
chromosome, so should find a chromosomally male relative with
the relevant surname to swab:
- a father, brother, nephew, cousin, etc., if her interest is
in her maiden surname;
or
- a husband, son, brother-in-law, father-in-law, etc., if her
interest is in her married
surname.
- Rare intersex conditions
prompted the need for the terms chromosomally male and chromosomally
female.
- Transgender people remain chromosomally male or chromosomally
female from birth.
- Sons raised by same sex partners still have a chromosomally
male genetic father (from whom they inherit a Y-chromosome) and
a chromosomally female genetic mother (from whom they inherit
mitochondrial DNA).
SNPs, STRs and DNA
signatures
- The Y-chromosome, like the surname, is passed virtually
unchanged from father to son.
- There are just occasional mutations or mistranscriptions in
the Y-chromosome just as there are occasional translations or
spelling changes in the surname.
- Over tens of thousands of years, these occasional mutations
add up to give a wide distribution of different Y-DNA signatures
today.
- Two types of mutation can be found on the Y chromosome, both
known by TLAs starting with S:
- A single-nucleotide polymorphism, abbreviated SNP
and pronounced snip, is a single location where there
is a relatively high degree of variation between different
people.
- For example, most people may have an A at one such
location, with a minority having a C.
- A short tandem repeat (STR) is a string of letters
consisting of the same short substring repeated several times,
for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated
seven times.
- The number of repeats may occasionally increase or
decrease between parent and child, due to mutations.
- FamilyTreeDNA.com first offered STR analysis in 2000 and
continues to do so, but STR analysis has now been overtaken by
SNP analysis for surname studies.
- A surname project or one-name study is a natural monopoly, so
FamilyTreeDNA has few effective competitors:
- Ancestry.com went out of the Y-DNA business on 5 September 2014
- its Y-DNA comparison database evaporated
- its physical Y-DNA samples were due to be destroyed
- customers had the option to download data and upload to
FTDNA
- YSEQ does
Whole Genome Testing, single SNP tests (USD18), etc.
- Ysearch
(to Y-DNA what GEDmatch is to autosomal DNA) is no longer
accessible as a result of General Data Protection Regulation
(GDPR).
- WorldFamilies.net, which hosted surname projects based on
results from the FTDNA lab, also closed down due to GDPR
fears in May 2018.
- The International Society of Genetic Genealogy (ISOGG) Wiki has more on options for STR testing and SNP testing.
- If you have autosomal DNA data with another company, you
should join FTDNA via the free autosomal transfer facility.
- If you (or a deceased relative) have already sent cheek
swabs to FamilyTreeDNA for Family Finder or mitochondrial
analysis, then they are held in storage and will be re-used
for Y-DNA analysis.
- Many SNPs are once-in-the-history-of-mankind mutations:
- When the mutation is first found, it is simply called a variant.
- When the variant is found consistently in multiple men, then
it is given a SNP name like R-ZS3700 or R-BY154784.
- The name prefixes are explained here.
- These named mutations have these important properties:
- They have occurred exactly once.
- Every man descended from the man in whom the mutation
originally occurred inherits the mutation.
- No other man has the mutation.
- Some groups of SNPs are equivalent SNPs, meaning
that they have so far been found only in the same men: for
example, R-FT702 today is equivalent to R-ZS3700.
- Equivalent SNPs form a branch of the human family
tree or Tree of Mankind,
often called the Y haplotree
or Y-DNA haplotree.
- Branches subdivide when a new man's sample is found to
contain some but not all of the equivalent SNPs.
- These SNP mutations are used to assign men to progressively
smaller and more recent haplogroups and to place them on
the Y haplotree, with the ultimate objective of identifying
surname-specific SNP mutations:
- Who was Y "Adam"?
- The "biblical Adam" was the first and only male in the world
at the time of creation.
- The "genetic Adam" or "Y-Adam", the most recent common
patrilineal ancestor of all men alive today, was merely the
only male in the world in his day whose male line descendants have not yet died out.
- Y-Adam is estimated to have lived between 160,000
and 300,000 years ago.
- As of 1 July 2021, 426,336 variants had been identified on
the Y chromosome by FamilyTreeDNA.com.
- On 6 December 2021, the 50,000th branch on the
Y haplotree was announced by FamilyTreeDNA.com.
- Surnames can be overlaid on the Tree of Mankind:
- Niall of the Nine Hostages branch (R-M222 SNP)
- Dalcassian branch (R-L226 SNP)
- All R-DCxxxx SNPs are descendants of R-L226.
- Results can be copied (free of charge) from
FamilyTreeDNA.com to The Big Tree.
- FamilyTreeDNA.com's Big-Y Block Tree is modelled on The Big
Tree.
- Or SNPs can be overlaid on surname trees from historical
annals:
- O'Hart wrote:
91. Cas: the elder son; a quo the Dal Cais
or "Dalcassians;" b. 347. Had twelve sons:—1. Blad, 2.
Caisin, 3. Lughaidh, 4. Seana, 5. Aengus Cinathrach, 6.
Carthann Fionn, 7. Cainioch, 8. Aengus Cinaithin, 9. Aodh,
10. Nae, 11. Loisgeann, and 12. Dealbheath.
- Families descended from Cas include
MacArthur, O'Beollan (or "Boland"), O'Brien, O’Brennan,
O'Casey, MacConsidine, O'Cormacan, Cosgrave, MacCraith, (or
MacGrath), O'Curry, Eustace, Glinn, Glynn, Hearne, O'Hogan,
O'Hurley, O'Kelleher, O'Kennedy, Magan, Maglin, MacMahon,
O'Meara, Muldowney (now "Downey"), O'Noonan, Power, Quirk,
O'Regan, Scanlan, O'Seasnain, and Twomey.
- Another version
- Examples of surname-specific or almost surname-specific SNPs:
- All R-BY19489+ men are Marrinans and there
are now six subgroups of the R-BY19489+
haplogroup comprised entirely of Marrinans and variant
spellings (Big Tree branch; FTDNA Marrinan project; Facebook appeal,
which brought in almost USD2,000 in ten days).
- Many O'Briens are R-DC782+, but so are one group of
O'Days/O'Deas (the Royal O'Deas, Big Tree branch; FTDNA O'Dea project)
- O'Dea and O'Brien clans fostered each other's children in
mediaeval times.
- Was there a surname/DNA switch?
- Did an O'Brien child fostered by the O'Dea clan take the
O'Dea surname?
- The Real O'Deas appear to be R-DC135+, as is a Fitzgerald:
- "Thomas Fitz Garrolde [Fitzgerald], alias Adaye [O'Dea],
Grutchins, Co. Kilkenny, gent." received a pardon in 1566.
- Jim Walsh in Sliabh
Rua: A History of its People and Places (p. 73)
raises the question:
Did Thomas O'Dea of Gorteens adopt his wife's
surname [Fitzgerald] on occasion out of political
expediency in his dealings with the Tudor government, or
did he have a Geraldine pedigree after all, which was
revised by such a marriage?
- Thomas's descendants certainly used the Fitzgerald
surname.
- DNA answers Walsh's question about the true genetic
surname: there was a surname/DNA switch in the 1500s.
- A man's place (or a surname's place) in the human family tree,
or his DNA signature,
is now generally described by the most recent confirmed SNP, misleadingly
described as the terminal SNP.
- "Terminal" has an implication of finality and permanence, but
a man's most recent confirmed SNP can actually change frequently
for two reasons:
- he may purchase additional SNP
tests (single SNPs, SNP packs or Big Y-700 at
USD379 until 31 December 2021) for SNPs which are descendants
of his current most recent confirmed SNP; and/or
- additional more recent once-in-the-history-of-mankind SNPs
(for which he is positive) may subsequently be discovered.
- SNPs and STRs can be combined into mutation history trees.
Relationships
between
surname groups and within surname groups
- SNP comparisons make it very easy to find relationships
between surname groups.
- SNP differences trump STR results regarding how closely two
men are related to one another.
- STR comparisons remain useful for estimating relationships
between men with the same surname and/or with the same terminal
SNP.
- So an STR product is still the entry-level purchase for most
men.
- Y-DNA37 can be ordered for USD79 until 31 December 2021.
- Patterns of STR values were the original
DNA signatures of surnames, but have been replaced by the more
definitive SNP signatures.
- SNP comparisons can prove or disprove relationships beyond a
reasonable doubt.
- STR comparisons can prove or disprove relationships on the
balance of probabilities.
- Patterns of STR values can still be used to predict SNPs.
- Comparisons of patterns of STR values is still the main method
used by FamilyTreeDNA.com to identify Y-DNA matches.
- In principle, your match list should contain dozens of men
with your exact surname.
- In practice, there are many reasons why this may not be the
case:
- your surname (or your male line beyond the adoption of your
surname) may not be one of those which have proliferated due
to many men of the surname (or male line) each having several
sons;
- your surname (or male line) may be in danger of being
"daughtered out", due to many men of the surname (or male
line) not marrying or fathering only daughters;
- there may be no other man of your surname in the FTDNA
database (e.g. no Geheran in
December 2021);
- there may be only a few people of your surname in the FTDNA
database (e.g. there were only 23 Dungans of either gender in
December 2021);
- there may have been no concerted effort to recruit men of
your surname to the FTDNA database;
- there may have been a concerted effort to recruit men of
some genetically related surname to the FTDNA database;
- the men of your surname in the FTDNA database may not yet
have ordered any Y-STR product;
- there may have been an above average number of STR mutations
in your male line in recent generations, resulting in few
matches of any surname;
- there may have been a below average number of STR mutations
in your male line since the adoption of surnames, resulting in
many matches with men whose common ancestry predates the use
of surnames;
- there may have been an overt or covert surname/DNA switch in your
male line since the adoption of surnames;
- your surname may have multiple independent genetic origins;
- your male line relatives may have translated the surname
back and forth between languages in different ways (see Sir
Robert Edwin Matheson's Varieties and synonymes of surnames and
Christian names in Ireland: for the guidance of registration
officers and the public in searching the indexes of births,
deaths, and marriages);
- your male line relatives may have settled on different
standardised spellings of the surname once the computer age
put an end to spelling diversity; and/or
- your close relatives may have reverted to an ancient
spelling of your surname discovered in their research.
- A surname/DNA switch is an event which results in a son
inheriting DNA from his genetic father, but not inheriting the
exact surname used by the genetic father.
- The spelling of surnames mutates over the generations in much
the same way as DNA mutates. After many generations, the
surnames used by two men from the same genetic male line may end
up being unrecognisably different.
- The surname/DNA switch
may replace the genetic father's surname with:
- a surname inherited from someone else; or
- a surname translated in some way from the genetic father's
surname.
- Surname/DNA switches are just one cause of surnames having
multiple DNA signatures.
- Many surnames, particularly occupational surnames and surnames
in countries which have had many immigrants speaking one or more
foreign languages, have multiple independent genetic origins for
more mundane reasons.
- When the surname does not follow the male line, some genetic
genealogists once used the term non-paternity event (NPE),
but most now prefer to refer to these occurences more precisely
as surname/DNA switches. After all, every birth involves
paternity, so NPE is now more usually expanded as "Not the
Parent Expected" and used when the DNA results do not match the
oral family tradition.
- Among the myriad of, possibly one-off, circumstances causing
surname/DNA switches (and other forms of NPE) are:
- adoption (including of foundlings), with the suname
inherited from the adoptive father;
- foundlings given a surname based on where or by whom they
were found;
- infidelity, with the surname inherited from the mother's
husband;
- use of sperm donors, with the surname inherited
from the man who raised the child;
- parents giving every second child the father's surname and
the mother's surname, with some inheriting the surname from
the mother;
- men using their mother's surname for other reasons;
- men using their stepfather's surname;
- a change of surname associated with inheritance of a family
estate, with the surname inherited from the benefactor;
- men going on the run for all sorts of reasons and changing
their surname to avoid being traced, whether running away from
the law, from political opponents, or from their
families, perhaps even wishing to commit
bigamy;
- men using their maternal grandmother's maiden surname (see example below);
- inconsistent standardisation of the spelling of a surname
once the computer age put an end to spelling diversity;
- reverting to an ancient spelling of a surname discovered in
the course of research;
- etc.
- For example, Osman Wilfred Kemal's mother
died in childbirth in 1909 and he was brought up by his maternal
grandmother Margaret Hannah Brun née Johnson and became known as
Wilfred Johnson. Wilfred Johnson's grandson, known as Boris
Johnson, became Prime Minister of the United Kingdom in July
2019. Prime Minister Johnson has Kemal Y-DNA, but a surname that
was not used by any of his eight greatgrandparents and that
descended via a female GGgrandparent. See here.
- Grants of arms have historically been associated with specific
families and never with surnames; thus sharing a surname does
not automatically confer the right to bear the same arms.
Similarly, sharing a surname does not automatically mean that
two men carry the same Y-DNA.
- My own Y-DNA111 matches as
of 11 February 2019 and as of 9 December 2021.
- My top Y-DNA67 matches as of 9
December 2021.
- My Big Y matches as of 10 December
2021.
- My branch of the Big Y Block Tree as
of 10 December 2021.
- My Warden Y-STR matches as of 10
December 2021.
- DNA provides only crude estimates of the number of generations
to the most recent common ancestor of two men.
- The TiP calculator
(now called the Time Predictor) estimates the number of
generations to the most recent common male line ancestor of
two STR matches.
- The equivalent rule-of-thumb for the SNP block trees is
roughly one mutation per century.
- The Carroll project is an example of a
multiple-origin surname with a wider variety of SNP and STR
signatures than the above-mentioned Marrinan project.
Setting up and
administering Y-DNA projects
- Y-DNA projects can be
- Once you have your initial Y-DNA results (or a known male-line
relative's Y-DNA results), you can join appropriate haplogroup
projects.
- Some older project member and project administrator features
have been disabled because of numerous changes prompted by GDPR
fears:
- You must Opt in to Sharing on the PROJECT PREFERENCES page or your
pseudonymized DNA results and ancestor information will be
missing from the public results pages.
- You can also choose from that page whether to give each
project administrator Minimum, Limited or Advanced access to
your kit; reducing access to Minimum pretty much eliminates
all the benefits of project membership.
- It is also recommended that you set Y-DNA Match Levels to
All Levels on the PRIVACY & SHARING page.
- If there is no existing project for your surname of interest,
then start your own, but ...
- The first prerequisite (thanks to GDPR) is to have an
e-mail address which you are prepared to expose to spammers
and to other non-FTDNA customers; you may wish to establish
a new e-mail address specifically for this purpose.
- Wikipedia until recently defined a data breach as
"the intentional or unintentional release of secure or
private/confidential information to an untrusted
environment".
- My long-standing guidelines
on e-mail etiquette demand that my correspondents
"please do not publish my e-mail address on any web page,
news group, chat room, etc."
- If you are an ordinary customer of FTDNA, only your
matches can see your e-mail address.
- If you are an FTDNA project administrator, everyone on the
internet, whether an FTDNA customer or not, sees your e-mail
address.
- This is part of the FTDNA Terms & Policies.
- If there is no surname project for your surname and you are
happy to deal with the spam risk, then you can apply to set up
your own project by following a simple five-step application process (which actually
consists of only four steps!).
- Every project has an activity feed for discussions between
members and administrators, which can be used by administrators
to avoid having to answer the same frequently asked questions
repeatedly via individual e-mails.
- Project administrators have valuable tools, including:
- a subgroup editor
to arrange members on the Y-DNA results pages
- subgroups are sorted alphabetically on the results pages,
so bear this in mind when choosing names
- criteria for grouping can include:
- surname
- geography
- haplotree position, whether
- confirmed by FTDNA
- predicted by FTDNA
- predicted by project administrator
- desire to see STR differences highlighted
- Subgroup Names (which are visible on the results pages)
were formerly truncated at 161 characters, without warning.
This increased to 200 characters on 2 November 2021, but
keep these names as short as possible with no unnecessary
spacing or punctuation.
- Subgroup Descriptions (which are visible to the project
administrator(s) only) appear to be truncated at 973
characters, without warning, and despite the false assurance
of scroll bars in the editor.
- a Y-DNA genetic distance calculator:
- this has greater thresholds than the matching algorithm:
7/37 instead of 4/37; 25/67 instead of 7/67 and 40/111
instead of 10/111
- examples: R-M222 for a man with one Y-DNA37
match with no SNP test; R-FGC29367 for a man with no Y-DNA111
match.
- a public website editor to publish information under any or
all of the following headings:
- Background
- Goals
- News
- Updates
- Bulletin
- Results
- Code of Conduct
- FAQ
- Project members can be recruited in many ways:
- FTDNA will send an e-mail on behalf of an administrator,
no more than once every six months, to all customers with
the relevant surname who have opted to receive such e-mails.
- Administrators can see project members' matches and can
e-mail them directly to invite them to join.
- Your may belong to an external surname organisation which
can run online and offline recruitment drives.
Conclusion: Why you should submit your DNA
- The value of DNA "testing" to genealogists
increases dramatically with the number of people with the
relevant surname already in the DNA databases used.
- But your money is better spent on advanced
testing for one man than on duplicate testing for two known
close relatives.
- Submitting your Y-DNA to a database has
significant positive externalities for existing and future
researchers, for example for
- your female relatives who don't have a Y
chromosome; or
- for men with a surname/DNA switch from
your surname to another surname somewhere in their lineage.
- We need to persuade more men to submit Y-DNA samples to the
databases for purely genealogical purposes.
- All of your
descendants will be eternally grateful to you for leaving
them a sample of your autosomal DNA.
- Your female
descendants will be eternally grateful to you for leaving
them a sample of your Y-DNA.
- Only if you
have produced male-line descendants are you absolved of your
personal responsibility to preserve and record your own
Y-DNA for posterity.
Further reading